MFI2 (MELTF) (NM_033316) Human Untagged Clone

CAT#: SC305611

MFI2 (untagged)-Human antigen p97 (melanoma associated) identified by monoclonal antibodies 133.2 and 96.5 (MFI2), transcript variant 2


  "NM_033316" in other vectors (4)

Reconstitution Protocol

USD 660.00

In Stock*

Size
    • 10 ug

Product Images

Other products for "MELTF"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol MELTF
Synonyms CD228; MAP97; MFI2; MTf; MTF1
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>OriGene sequence for NM_033316 edited
GCCACCATGCGGGGTCCGAGCGGGGCTCTGTGGCTGCTCCTGGCTCTGCGCACCGTGCTC
GGTGGCATGGAGGTGCGGTGGTGCGCCACCTCGGACCCAGAGCAGCACAAGTGCGGCAAC
ATGAGCGAGGCCTTCCGGGAAGCGGGCATCCAGCCCTCCCTCCTCTGCGTCCGGGGCACC
TCCGCCGACCACTGCGTCCAGCTCATCGCGGCCCAGGAGGCTGACGCCATCACTCTGGAT
GGAGGAGCCATCTATGAGGCGGGAAAGGAGCACGGCCTGAAGCCGGTGGTGGGCGAAGTG
TACGATCAAGAGGTCGGTACCTCCTATTACGCCGTGGCTGTGGTCAGGAGGAGCTCCCAT
GTGACCATTGACACCCTGAAAGGCGTGAAGTCCTGCCACACGGGCATCAATCGCACAGTG
GGCTGGAACGTGCCCGTGGGCTACCTGGTGGAGAGCGGCCGCCTCTCGGTGATGGGCTGC
GATGTACTCAAAGCTGTCAGCGACTATTTTGGGGGCAGCTGCGTCCCGGGGGCAGGAGAG
ACCAGTTACTCTGAGTCCCTCTGTCGCCTCTGCAGGGGTGACAGCTCTGGGGAAGGGGTG
TGTGACAAGAGCCCCCTGGAGAGATACTACGACTACAGCGGGGCCTTCCGGTGCCTGGCG
GAAGGGGCAGGGGACGTGGCTTTTGTGAAGCACAGCACGGTACTGGAGAACACGGATGAA
AGTCCATCACGAAGGCAAACATGGACCAGATCTGAGGAGGAAGAAGGCGAGTGCCCTGCA
CACGAGGAAGCACGTAGGACGATGCGCTCTAGTGCTGGGCAAGCCTGGAAATGGGCTCCC
GTTCACAGGCCCCAGGACGAGTCTGACAAAGGAGAATTTGGAAAACGGGCAAAGAGTAGG
GATATGTTGGGTTAA
Restriction Sites Please inquire     
ACCN NM_033316
Insert Size 1000 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_033316.2, NP_201573.1
RefSeq Size 1651 bp
RefSeq ORF 909 bp
Locus ID 4241
Cytogenetics 3q29
Protein Families Druggable Genome
Gene Summary 'The protein encoded by this gene is a cell-surface glycoprotein found on melanoma cells. The protein shares sequence similarity and iron-binding properties with members of the transferrin superfamily. The importance of the iron binding function has not yet been identified. This gene resides in the same region of chromosome 3 as members of the transferrin superfamily. Alternative splicing results in two transcript variants. [provided by RefSeq, Jul 2008]'
Transcript Variant: This variant (2) differs from variant 1 in the central coding region, resulting in a frameshift. The encoded isoform (2) has a truncated and distinct C-terminus and lacks the propeptide compared to isoform 1.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.