MVB12B (NM_033446) Human Untagged Clone

CAT#: SC305635

MVB12B (untagged)-Human family with sequence similarity 125, member B (FAM125B), transcript variant 1


  "NM_033446" in other vectors (6)

Reconstitution Protocol

USD 660.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "MVB12B"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol MVB12B
Synonyms C9orf28; FAM125B
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_033446, the custom clone sequence may differ by one or more nucleotides


ATGAGAAGCTGCTTCTGCGTGAGACGGAGCCGGGACCCGCCGCCGCCGCAGCCACCGCCGCCGCCGCCCC
AGCGGGGAACAGACCAGTCCACCATGCCTGAAGTCAAAGACCTCTCAGAAGCCTTGCCAGAAACGTCAAT
GGATCCCATCACGGGAGTCGGGGTGGTGGCTTCTCGGAACCGAGCCCCGACAGGCTATGACGTAGTTGCA
CAGACAGCAGATGGTGTGGATGCTGACCTCTGGAAAGACGGCTTATTTAAATCCAAGGTTACCAGATACC
TGTGTTTCACAAGATCATTTTCCAAAGAAAATAGTCATCTGGGGAACGTGTTAGTAGATATGAAGCTCAT
TGACATCAAGGACACACTGCCTGTGGGCTTCATCCCAATTCAGGAGACGGTGGACACACAGGAAGTGGCT
TTTAGGAAGAAGAGGCTGTGCATTAAATTTATTCCACGGGATTCAACGGAAGCTGCGATTTGTGACATTC
GGATCATGGGCCGGACCAAGCAGGCCCCGCCTCAGTACACGTTTATTGGGGAACTGAACAGCATGGGGAT
CTGGTATCGAATGGGCAGAGTACCAAGAAATCATGACTCATCTCAACCCACAACGCCTTCCCAGTCATCA
GCTGCCTCCACCCCAGCCCCCAACCTTCCCAGGCACATCTCCCTAACACTTCCTGCCACCTTCCGAGGCA
GGAACAGCACCCGGACGGACTACGAGTACCAGCACTCCAATTTGTATGCCATATCAGCAATGGATGGTGT
GCCTTTTATGATTTCAGAGAAGTTTTCTTGTGTTCCAGAAAGTATGCAGCCCTTTGATCTCCTGGGAATC
ACCATCAAATCTCTAGCAGAAATCGAAAAAGAGTACGAGTACAGCTTCCGCACAGAGCAGAGCGCAGCCG
CCAGGCTCCCGCCCAGCCCCACCAGGTGTCAGCAGATCCCGCAGTCCTGA


Restriction Sites SgfI-MluI     
ACCN NM_033446
ORF Size 960 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Reference Data
RefSeq NM_033446.2, NP_258257.1
RefSeq Size 4842
RefSeq ORF 960
Locus ID 89853
Protein Pathways Endocytosis
Gene Summary The protein encoded by this gene is a component of the ESCRT-I complex, a heterotetramer, which mediates the sorting of ubiquitinated cargo protein from the plasma membrane to the endosomal vesicle. ESCRT-I complex plays an essential role in HIV budding and endosomal protein sorting. Depletion and overexpression of this and related protein (MVB12A) inhibit HIV-1 infectivity and induce unusual viral assembly defects, indicating a role for MVB12 subunits in regulating ESCRT-mediated virus budding. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2011]
Transcript Variant: This variant (1) represents the predominant transcript, and encodes the longer isoform (1).

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.