WNT16 (NM_057168) Human Untagged Clone

CAT#: SC305748

WNT16 (untagged)-Human wingless-type MMTV integration site family, member 16 (WNT16), transcript variant 1

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: WNT16
• Synonyms: wingless-related MMTV integration site 16; wingless-type MMTV integration site family, member 16
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_057168, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGACAGGGCGGCGCTCCTGGGACTGGCCCGCTTGTGCGCGCTGTGGGCAGCCCTGCTCGTGCTGTTCC
  CCTACGGAGCCCAAGGAAACTGGATGTGGTTGGGCATTGCCTCCTTCGGGGTTCCAGAGAAGCTGGGCTG
  CGCCAATTTGCCGCTGAACAGCCGCCAGAAGGAGCTGTGCAAGAGGAAACCGTACCTGCTGCCGAGCATC
  CGAGAGGGCGCCCGGCTGGGCATTCAGGAGTGCGGGAGCCAGTTCAGACACGAGAGATGGAACTGCATGA
  TCACCGCCGCCGCCACTACCGCCCCGATGGGCGCCAGCCCCCTCTTTGGCTACGAGCTGAGCAGCGGCAC
  CAAAGAGACAGCATTTATTTATGCTGTGATGGCTGCAGGCCTGGTGCATTCTGTGACCAGGTCATGCAGT
  GCAGGCAACATGACAGAGTGTTCCTGTGACACCACCTTGCAGAACGGCGGCTCAGCAAGTGAAGGCTGGC
  ACTGGGGGGGCTGCTCCGATGATGTCCAGTATGGCATGTGGTTCAGCAGAAAGTTCCTAGATTTCCCCAT
  CGGAAACACCACGGGCAAAGAAAACAAAGTACTATTAGCAATGAACCTACATAACAATGAAGCTGGAAGG
  CAGGCTGTCGCCAAGTTGATGTCAGTAGACTGCCGCTGCCACGGAGTTTCCGGCTCCTGTGCTGTGAAAA
  CATGCTGGAAAACCATGTCTTCTTTTGAAAAGATTGGCCATTTGTTGAAGGATAAATATGAAAACAGTAT
  CCAGATATCAGACAAAACAAAGAGGAAAATGCGCAGGAGAGAAAAAGATCAGAGGAAAATACCAATCCAT
  AAGGATGATCTGCTCTATGTTAATAAGTCTCCCAACTACTGTGTAGAAGATAAGAAACTGGGAATCCCAG
  GGACACAAGGCAGAGAATGCAACCGTACATCAGAGGGTGCAGATGGCTGCAACCTCCTCTGCTGTGGCCG
  AGGTTACAACACCCATGTGGTCAGGCACGTGGAGAGGTGTGAGTGTAAGTTCATCTGGTGCTGCTATGTC
  CGTTGCAGGAGGTGTGAAAGCATGACTGATGTCCACACTTGCAAGTAA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_057168
• ORF Size: 1098 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_057168.1, NP_476509.1
• RefSeq Size: 3132
• RefSeq ORF: 1098
• Locus ID: 51384
• Protein Families: Secreted Protein, Transmembrane
• Protein Pathways: Basal cell carcinoma, Hedgehog signaling pathway, Melanogenesis, Pathways in cancer, Wnt signaling pathway
• Gene Summary: The WNT gene family consists of structurally related genes which encode secreted signaling proteins. These proteins have been implicated in oncogenesis and in several developmental processes, including regulation of cell fate and patterning during embryogenesis. This gene is a member of the WNT gene family. It contains two transcript variants diverging at the 5' termini. These two variants are proposed to be the products of separate promoters and not to be splice variants from a single promoter. They are differentially expressed in normal tissues, one of which (variant 2) is expressed at significant levels only in the pancreas, whereas another one (variant 1) is expressed more ubiquitously with highest levels in adult kidney, placenta, brain, heart, and spleen. [provided by RefSeq, Jul 2008]
  Transcript Variant: This variant (1) differs from variant 2 at the 5' terminus including 5' UTR and the coding region for the N-terminus. Isoform 1, encoded by this variant, is 90% identical to the mouse Wnt16 protein at the amino acid level.