DNASE2B (NM_058248) Human Untagged Clone

CAT#: SC305776

DNASE2B (untagged)-Human deoxyribonuclease II beta (DNASE2B), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: DNASE2B
• Synonyms: DLAD
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_058248, the custom clone sequence may differ by one or more nucleotides
  ATGCCCCAGCTGTGCACCAGGGCCAGCTCATCAGAGATTCCTGGCAGGCTCCTCACCACA
  CTTCAGTCGGCCCAGGGACAAAAATTCCTCCATTTTGCAAAGTCGGATTCTTTTCTTGAC
  GACATCTTTGCAGCCTGGATGGCTCAACGGCTGAAGACACACTTGTTAACAGAAACCTGG
  CAGCGAAAAAGACAAGAGCTTCCTTCAAACTGCTCCCTTCCTTACCATGTCTACAATATA
  AAAGCAATTAAATTATCACGACACTCTTATTTCAGTTCTTATCAAGATCATGCCAAGTGG
  TGTATTTCCCAAAAGGGCACCAAAAATCGCTGGACATGTATTGGAGACCTAAATCGGAGT
  CCACACCAAGCCTTCAGAAGTGGAGGATTCATTTGTACCCAGAATTGGCAAATTTACCAA
  GCATTTCAAGGATTAGTATTATACTATGAAAGCTGTAAGTAA
  
• Restriction Sites: Please inquire
• ACCN: NM_058248
• ORF Size: 462 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_058248.1, NP_490649.1
• RefSeq Size: 1029
• RefSeq ORF: 462
• Locus ID: 58511
• Protein Families: Transmembrane
• Protein Pathways: Lysosome
• Gene Summary: The protein encoded by this gene shares considerable sequence similarity to, and is structurally related to DNase II. The latter is a well characterized endonuclease that catalyzes DNA hydrolysis in the absence of divalent cations at acidic pH. Unlike DNase II which is ubiquitously expressed, expression of this gene product is restricted to the salivary gland and lungs. The gene has been localized to chromosome 1p22.3 adjacent (and in opposite orientation) to the uricase pseudogene. Two transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Jul 2008]
  Transcript Variant: This variant (2) lacks the first two exons present in transcript variant 1. However, it maintains the same reading frame and encodes an isoform (2) which is truncated at the N-terminus compared to isoform 1. Isoform 2 is specifically expressed in the lungs.