DUSP15 (NM_080611) Human Untagged Clone

CAT#: SC305802

DUSP15 (untagged)-Human dual specificity phosphatase 15 (DUSP15), transcript variant 1

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: DUSP15
• Synonyms: C20orf57; VHY
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_080611, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGGCAATGGCATGACCAAGGTACTTCCTGGACTCTACCTCGGAAACTTCATTGATGCCAAAGACCTGG
  ATCAGCTGGGCCGAAATAAGATCACACACATCATCTCTATCCATGAGTCACCCCAGCCTCTGCTGCAGGA
  TATCACCTACCTTCGCATCCCGGTCGCTGATACCCCTGAGGTACCCATCAAAAAGCACTTCAAAGAATGT
  ATCAACTTCATCCACTGCTGCCGCCTTAATGGGGGGAACTGCCTTGTGCACTGCTTTGCAGGCATCTCTC
  GCAGCACCACGATTGTGACAGCGTATGTGATGACTGTGACGGGGCTAGGCTGGCGGGACGTGCTTGAAGC
  CATCAAGGCCACCAGGCCCATCGCCAACCCCAACCCAGGCTTTAGGCAGCAGCTTGAAGAGTTTGGCTGG
  GCCAGTTCCCAGAAGCTTCGCCGGCAGCTGGAGGAGCGCTTCGGCGAGAGCCCCTTCCGCGACGAGGAGG
  AGTTGCGCGCGCTGCTGCCGCTGTGCAAGCGCTGCCGGCAGGGCTCCGCGACCTCGGCCTCCTCCGCCGG
  GCCGCACTCAGCAGCCTCCGAGGGAACCGTGCAGCGCCTGGTGCCGCGCACGCCCCGGGAAGCCCACCGG
  CCGCTGCCGCTGCTGGCGCGCGTCAAGCAGACTTTCTCTTGCCTCCCCCGGTGTCTGTCCCGCAAGGGCG
  GCAAGTGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_080611
• ORF Size: 708 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_080611.4, NP_542178.2
• RefSeq Size: 1451
• RefSeq ORF: 708
• Locus ID: 128853
• Protein Families: Druggable Genome, Phosphatase
• Gene Summary: The protein encoded by this gene has both protein-tyrosine phophatase activity and serine/threonine-specific phosphatase activity, and therefore is known as a dual specificity phosphatase. This protein may function in the differentiation of oligodendrocytes. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2016]
  Transcript Variant: This variant (1) encodes isoform a.