DUSP15 (NM_080611) Human Untagged Clone

CAT#: SC305802

DUSP15 (untagged)-Human dual specificity phosphatase 15 (DUSP15), transcript variant 1


  "NM_080611" in other vectors (6)

Reconstitution Protocol

USD 420.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "DUSP15"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol DUSP15
Synonyms C20orf57; VHY
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_080611, the custom clone sequence may differ by one or more nucleotides


ATGGGCAATGGCATGACCAAGGTACTTCCTGGACTCTACCTCGGAAACTTCATTGATGCCAAAGACCTGG
ATCAGCTGGGCCGAAATAAGATCACACACATCATCTCTATCCATGAGTCACCCCAGCCTCTGCTGCAGGA
TATCACCTACCTTCGCATCCCGGTCGCTGATACCCCTGAGGTACCCATCAAAAAGCACTTCAAAGAATGT
ATCAACTTCATCCACTGCTGCCGCCTTAATGGGGGGAACTGCCTTGTGCACTGCTTTGCAGGCATCTCTC
GCAGCACCACGATTGTGACAGCGTATGTGATGACTGTGACGGGGCTAGGCTGGCGGGACGTGCTTGAAGC
CATCAAGGCCACCAGGCCCATCGCCAACCCCAACCCAGGCTTTAGGCAGCAGCTTGAAGAGTTTGGCTGG
GCCAGTTCCCAGAAGCTTCGCCGGCAGCTGGAGGAGCGCTTCGGCGAGAGCCCCTTCCGCGACGAGGAGG
AGTTGCGCGCGCTGCTGCCGCTGTGCAAGCGCTGCCGGCAGGGCTCCGCGACCTCGGCCTCCTCCGCCGG
GCCGCACTCAGCAGCCTCCGAGGGAACCGTGCAGCGCCTGGTGCCGCGCACGCCCCGGGAAGCCCACCGG
CCGCTGCCGCTGCTGGCGCGCGTCAAGCAGACTTTCTCTTGCCTCCCCCGGTGTCTGTCCCGCAAGGGCG
GCAAGTGA


Restriction Sites SgfI-MluI     
ACCN NM_080611
ORF Size 708 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Reference Data
RefSeq NM_080611.4, NP_542178.2
RefSeq Size 1451
RefSeq ORF 708
Locus ID 128853
Protein Families Druggable Genome, Phosphatase
Gene Summary The protein encoded by this gene has both protein-tyrosine phophatase activity and serine/threonine-specific phosphatase activity, and therefore is known as a dual specificity phosphatase. This protein may function in the differentiation of oligodendrocytes. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2016]
Transcript Variant: This variant (1) encodes isoform a.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.