XAGE5 (NM_130775) Human Untagged Clone

CAT#: SC305902

XAGE5 (untagged)-Human X antigen family, member 5 (XAGE5)

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: XAGE5
• Synonyms: CT12.5; GAGED5; XAGE-5
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_130775, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGAGTTGGCGAGGAAGAAGATATAGACCAAGACGATGTTTACGACTTGCTCAGCTGGTTGGGCCTATGC
  TTGAGCCCAGTGTGCCAGAGCCTCAACAAGAAGAACCACCAACTGAAAGTCAGGATCATACACCTGGTCA
  GAAGAGAGAAGATGATCAGGGTGCAGCTGAGATTCAAGTGCCTAACCTGGAAGCTGATCTCCAGGAGCTG
  TCTCAGTCAAAGACTGGGGATGAATGCGGAGATAGTCCTGATGTCCAGGGGAAGATTCTGCCAAAATCAG
  AGCAATTTAAAATGCCAGAAGGAGGGGAAGGGAAACCACAGCTTTAA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_130775
• ORF Size: 327 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_130775.2, NP_570131.1
• RefSeq Size: 477
• RefSeq ORF: 327
• Locus ID: 170627
• Gene Summary: This gene is a member of the XAGE subfamily, which belongs to the GAGE family. The GAGE genes are expressed in a variety of tumors and in some fetal and reproductive tissues. The protein encoded by this gene shares a sequence similarity with other GAGE/PAGE proteins. Because of the expression pattern and the sequence similarity, this protein also belongs to a family of CT (cancer-testis) antigens. [provided by RefSeq, Jul 2008]