ATP6V1G3 (NM_133262) Human Untagged Clone
CAT#: SC305936
ATP6V1G3 (untagged)-Human ATPase, H+ transporting, lysosomal 13kDa, V1 subunit G3 (ATP6V1G3), transcript variant 1
"NM_133262" in other vectors (4)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | ATP6V1G3 |
Synonyms | ATP6G3; Vma10 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_133262, the custom clone sequence may differ by one or more nucleotides
ATGACAAGCCAGTCTCAGGGGATCCACCAGCTTCTTCAGGCAGAAAAACGGGCCAAGGACAAGCTAGAGG AAGCCAAGAAGAGAAAAGGAAAGCGATTGAAGCAAGCCAAGGAGGAAGCAATGGTAGAAATTGACCAGTA CAGAATGCAGAGAGATAAAGAGTTTCGACTAAAACAATCTAAGATAATGGGCTCTCAGAATAATCTCTCA GATGAAATAGAAGAACAAACACTAGGGAAGATACAAGAACTTAATGGACACTACAATAAGTATATGGAAA GTGTGATGAACCAGCTCTTGAGCATGGTCTGTGACATGAAACCAGAAATCCATGTGAACTACAGAGCCAC CAACTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_133262 |
ORF Size | 357 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Reference Data | |
RefSeq | NM_133262.2, NP_573569.1 |
RefSeq Size | 645 |
RefSeq ORF | 357 |
Locus ID | 127124 |
Protein Pathways | Epithelial cell signaling in Helicobacter pylori infection, Metabolic pathways, Oxidative phosphorylation, Vibrio cholerae infection |
Gene Summary | This gene encodes a component of vacuolar ATPase (V-ATPase), a multisubunit enzyme that mediates acidification of eukaryotic intracellular organelles. V-ATPase dependent organelle acidification is necessary for such intracellular processes as protein sorting, zymogen activation, receptor-mediated endocytosis, and synaptic vesicle proton gradient generation. V-ATPase is composed of a cytosolic V1 domain and a transmembrane V0 domain. The V1 domain consists of three A and three B subunits, two G subunits plus the C, D, E, F, and H subunits. The V1 domain contains the ATP catalytic site. The V0 domain consists of five different subunits: a, c, c', c'' and d. Additional isoforms of many of the V1 and V0 subunit proteins are encoded by multiple genes or alternatively spliced transcript variants. This gene encodes one of three G subunit proteins. Transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (1) lacks an alternate in-frame exon in the 5' coding region, compared to variant 3. It encodes isoform a, which lacks an internal segment and is shorter, compared to isoform c. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC221453 | ATP6V1G3 (Myc-DDK-tagged)-Human ATPase, H+ transporting, lysosomal 13kDa, V1 subunit G3 (ATP6V1G3), transcript variant 1 |
USD 420.00 |
|
RG221453 | ATP6V1G3 (GFP-tagged) - Human ATPase, H+ transporting, lysosomal 13kDa, V1 subunit G3 (ATP6V1G3), transcript variant 1 |
USD 460.00 |
|
RC221453L3 | Lenti ORF clone of Human ATPase, H+ transporting, lysosomal 13kDa, V1 subunit G3 (ATP6V1G3), transcript variant 1, Myc-DDK-tagged |
USD 620.00 |
|
RC221453L4 | Lenti ORF clone of Human ATPase, H+ transporting, lysosomal 13kDa, V1 subunit G3 (ATP6V1G3), transcript variant 1, mGFP tagged |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review