ATP6V1G3 (NM_133262) Human Untagged Clone

CAT#: SC305936

ATP6V1G3 (untagged)-Human ATPase, H+ transporting, lysosomal 13kDa, V1 subunit G3 (ATP6V1G3), transcript variant 1


  "NM_133262" in other vectors (4)

Reconstitution Protocol

USD 420.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "ATP6V1G3"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol ATP6V1G3
Synonyms ATP6G3; Vma10
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_133262, the custom clone sequence may differ by one or more nucleotides


ATGACAAGCCAGTCTCAGGGGATCCACCAGCTTCTTCAGGCAGAAAAACGGGCCAAGGACAAGCTAGAGG
AAGCCAAGAAGAGAAAAGGAAAGCGATTGAAGCAAGCCAAGGAGGAAGCAATGGTAGAAATTGACCAGTA
CAGAATGCAGAGAGATAAAGAGTTTCGACTAAAACAATCTAAGATAATGGGCTCTCAGAATAATCTCTCA
GATGAAATAGAAGAACAAACACTAGGGAAGATACAAGAACTTAATGGACACTACAATAAGTATATGGAAA
GTGTGATGAACCAGCTCTTGAGCATGGTCTGTGACATGAAACCAGAAATCCATGTGAACTACAGAGCCAC
CAACTAA


Restriction Sites SgfI-MluI     
ACCN NM_133262
ORF Size 357 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Reference Data
RefSeq NM_133262.2, NP_573569.1
RefSeq Size 645
RefSeq ORF 357
Locus ID 127124
Protein Pathways Epithelial cell signaling in Helicobacter pylori infection, Metabolic pathways, Oxidative phosphorylation, Vibrio cholerae infection
Gene Summary This gene encodes a component of vacuolar ATPase (V-ATPase), a multisubunit enzyme that mediates acidification of eukaryotic intracellular organelles. V-ATPase dependent organelle acidification is necessary for such intracellular processes as protein sorting, zymogen activation, receptor-mediated endocytosis, and synaptic vesicle proton gradient generation. V-ATPase is composed of a cytosolic V1 domain and a transmembrane V0 domain. The V1 domain consists of three A and three B subunits, two G subunits plus the C, D, E, F, and H subunits. The V1 domain contains the ATP catalytic site. The V0 domain consists of five different subunits: a, c, c', c'' and d. Additional isoforms of many of the V1 and V0 subunit proteins are encoded by multiple genes or alternatively spliced transcript variants. This gene encodes one of three G subunit proteins. Transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (1) lacks an alternate in-frame exon in the 5' coding region, compared to variant 3. It encodes isoform a, which lacks an internal segment and is shorter, compared to isoform c.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.