XAGE1D (NM_133430) Human Untagged Clone

CAT#: SC305950

XAGE1D (untagged)-Human X antigen family, member 1D (XAGE1D), transcript variant d

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: XAGE1D
• Synonyms: CT12.1; CT12.1D; CTP9
• Vector: pCMV6-XL5
• E. coli Selection: Ampicillin (100 ug/mL)
• Mammalian Cell Selection: None
• Sequence Data:
  Fully Sequenced ORF

  >OriGene ORF sequence for NM_133430 edited
  ATGGAGAGCCCCAAAAAGAAGAACCAGCAGCTGAAAGTCGGGATCCTACACCTGGGCAGC
  AGACAGAAGAAGATCAGGATACAGCTGAGATCCCAGGTGCTGGGAAGGGAAATGCGCGAC
  ATGGAAGGTGATCTGCAAGAGCTGCATCAGTCAAACACCGGGGATAAATCTGGATTTGGG
  TTCCGGCGTCAAGGTGAAGATAATACCTAA
  
• Restriction Sites: Please inquire
• ACCN: NM_133430
• ORF Size: 210 bp
• Insert Size: 600
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This clone was fully sequenced and ORF matches with that of NM_133430.1.

Reference Data

• RefSeq: NM_133430.1, NP_597673.1
• RefSeq Size: 481
• RefSeq ORF: 210
• Locus ID: 9503
• Gene Summary: This gene is a member of the XAGE subfamily, which belongs to the GAGE family. The GAGE genes are expressed in a variety of tumors and in some fetal and reproductive tissues. This gene is strongly expressed in Ewing's sarcoma, alveolar rhabdomyosarcoma and normal testis. The protein encoded by this gene contains a nuclear localization signal and shares a sequence similarity with other GAGE/PAGE proteins. Because of the expression pattern and the sequence similarity, this protein also belongs to a family of CT (cancer-testis) antigens. Alternative splicing of this gene, in addition to alternative transcription start sites, results in multiple transcript variants. [provided by RefSeq, Jan 2010]
  Transcript Variant: This variant (d, also known as XAGE-1d) starts at a downstream transcription start site, and uses an alternate splice site in an internal exon that causes a frameshift in the 3' coding region, compared to variant a. The encoded isoform (d) has a distinct and shorter C-terminus, compared to isoform a.