ASAH3 (ACER1) (NM_133492) Human Untagged Clone

CAT#: SC305969

ACER1 (untagged)-Human alkaline ceramidase 1 (ACER1)

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: ACER1
• Synonyms: ALKCDase1; ASAH3
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_133492, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGCCTAGCATCTTCGCCTATCAGAGCTCCGAGGTGGACTGGTGTGAGAGCAACTTCCAGTACTCGGAGC
  TGGTGGCCGAGTTCTACAACACGTTCTCCAATATCCCCTTCTTCATCTTCGGGCCACTGATGATGCTCCT
  GATGCACCCGTATGCCCAGAAGCGCTCCCGCTACATTTACGTTGTCTGGGTCCTCTTCATGATCATAGGC
  CTGTTCTCCATGTATTTCCACATGACGCTCAGCTTCCTGGGCCAGCTGCTGGACGAGATCGCCATCCTGT
  GGCTCCTGGGCAGTGGCTATAGCATATGGATGCCCCGCTGCTATTTCCCCTCCTTCCTTGGGGGGAACAG
  GTCCCAGTTCATCCGCCTGGTCTTCATCACCACTGTGGTCAGCACCCTTCTGTCCTTCCTGCGGCCCACG
  GTCAACGCCTACGCCCTCAACAGCATTGCCCTGCACATTCTCTACATCGTGTGCCAGGAGTACAGGAAGA
  CCAGCAATAAGGAGCTTCGGCACCTGATTGAGGTCTCCGTGGTTTTATGGGCTGTTGCTCTGACCAGCTG
  GATCAGTGACCGTCTGCTTTGCAGCTTCTGGCAGAGGATTCATTTCTTCTATCTGCACAGCATCTGGCAT
  GTGCTCATCAGCATCACCTTCCCTTATGGCATGGTCACCATGGCCTTGGTGGATGCCAACTATGAGATGC
  CAGGTGAAACCCTCAAAGTCCGCTACTGGCCTCGGGACAGTTGGCCCGTGGGGCTGCCCTACGTGGAAAT
  CCGGGGTGATGACAAGGACTGCTGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_133492
• ORF Size: 795 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_133492.2, NP_597999.1
• RefSeq Size: 1088
• RefSeq ORF: 795
• Locus ID: 125981
• Protein Families: Transmembrane
• Protein Pathways: Metabolic pathways, Sphingolipid metabolism
• Gene Summary: Ceramides are synthesized during epidermal differentiation and accumulate within the interstices of the stratum corneum, where they represent critical components of the epidermal permeability barrier. Excess cellular ceramide can trigger antimitogenic signals and induce apoptosis, and the ceramide metabolites sphingosine and sphingosine-1-phosphate (S1P) are important bioregulatory molecules. Ceramide hydrolysis in the nucleated cell layers regulates keratinocyte proliferation and apoptosis in response to external stress. Ceramide hydrolysis also occurs at the stratum corneum, releasing free sphingoid base that functions as an endogenous antimicrobial agent. ACER1 is highly expressed in epidermis and catalyzes the hydrolysis of very long chain ceramides to generate sphingosine (Houben et al., 2006 [PubMed 16477081]; Sun et al., 2008 [PubMed 17713573]). [supplied by OMIM, Jul 2010]