SPACA4 (NM_133498) Human Untagged Clone

CAT#: SC305970

SPACA4 (untagged)-Human sperm acrosome associated 4 (SPACA4)

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: SPACA4
• Synonyms: SAMP14
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_133498, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGTCCTGTGCTGGCTGCTGCTTCTGGTGATGGCTCTGCCCCCAGGCACGACGGGCGTCAAGGACTGCG
  TCTTCTGTGAGCTCACCGACTCCATGCAGTGTCCTGGTACCTACATGCACTGTGGCGATGACGAGGACTG
  CTTCACAGGCCACGGGGTCGCCCCGGGCACTGGTCCGGTCATCAACAAAGGCTGCCTGCGAGCCACCAGC
  TGCGGCCTTGAGGAACCCGTCAGCTACAGGGGCGTCACCTACAGCCTCACCACCAACTGCTGCACCGGCC
  GCCTGTGTAACAGAGCCCCGAGCAGCCAGACAGTGGGGGCCACCACCAGCCTGGCACTGGGGCTGGGTAT
  GCTGCTTCCTCCACGTTTGCTGTGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_133498
• ORF Size: 375 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_133498.2, NP_598005.1
• RefSeq Size: 978
• RefSeq ORF: 375
• Locus ID: 171169
• Gene Summary: Sperm surface membrane protein that may be involved in sperm-egg plasma membrane adhesion and fusion during fertilization. [UniProtKB/Swiss-Prot Function]