CD99L2 (NM_134446) Human Untagged Clone

CAT#: SC305990

CD99L2 (untagged)-Human CD99 molecule-like 2 (CD99L2), transcript variant 2


  "NM_134446" in other vectors (4)

Reconstitution Protocol

USD 420.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "CD99L2"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol CD99L2
Synonyms CD99B; MIC2L1
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_134446, the custom clone sequence may differ by one or more nucleotides
ATGGTGGCCTGGCGCTCGGCGTTCCTTGTCTGCCTCGCTTTCTCCTTGGCCACCCTGGTC
CAGCGAGGATCTGGGGACTTTGATGATTTTAACCTGGAGGATGCAGTGAAAGAAACTTCC
TCAGTAAAGCAGAGATGGAACCATGTAACCACCACGACCAAGAGGCCAGTAACCACCAGA
GCTCCAGCAAATACTTTAGGAAATGATTTTGACTTGGCTGATGCCCTGGATGATCGAAAT
GATCGAGATGATGGCCGCAGGAAACCAATTGCTGGAGGAGGAGGTTTTTCAGACAAGGAT
CTTGAAGACATAGTAGGGGGTGGAGAATACAAACCTGACAAGGGTAAAGGTGATGGCCGG
TACGGCAGCAATGACGACCCTGGATCTGGCATGGTGGCAGAGCCTGGCACCATTGCCGGG
GTGGCCAGCGCCCTGGCCATGGCCCTCATCGGTGCCGTCTCCAGCTACATCTCCTACCAG
CAGAAGAAGTTCTGCTTCAGCATTCAGCAGGGTCTCAACGCAGACTACGTGAAGGGAGAG
AACCTGGAAGCCGTGGTATGTGAGGAACCCCAAGTGAAATACTCCACGTTGCACACGCAG
TCTGCAGAGCCGCCGCCGCCGCCCGAACCAGCCCGGATCTGA
Restriction Sites Please inquire     
ACCN NM_134446
ORF Size 642 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Reference Data
RefSeq NM_134446.2, NP_604395.1
RefSeq Size 3488
RefSeq ORF 642
Locus ID 83692
Protein Families Transmembrane
Gene Summary This gene encodes a cell-surface protein that is similar to CD99. A similar protein in mouse functions as an adhesion molecule during leukocyte extravasation. Alternate splicing results in multiple transcript variants. [provided by RefSeq, May 2010]
Transcript Variant: This variant (2) lacks two consecutive in-frame exons in one region and an in-frame exon in another region, compared to variant 5. The resulting isoform (2, also referred to as E3-E4) lacks two internal segments, compared to isoform 5.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.