PANK1 (NM_138316) Human Untagged Clone

CAT#: SC306006

PANK1 (untagged)-Human pantothenate kinase 1 (PANK1), transcript variant gamma

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: PANK1
• Synonyms: PANK
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_138316, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGAAGCTTATAAATGGCAAAAAGCAAACATTCCCATGGTTTGGCATGGACATCGGTGGAACGCTGGTTA
  AATTGGTGTATTTCGAGCCGAAGGATATTACAGCCGAAGAGGAGCAAGAGGAAGTGGAGAACCTGAAGAG
  CATCCGGAAGTATTTGACTTCTAATACTGCTTATGGGAAAACTGGGATCCGAGACGTCCACCTGGAACTG
  AAAAACCTGACCATGTGTGGACGCAAAGGGAACCTGCACTTCATCCGCTTTCCCAGCTGTGCTATGCACA
  GGTTCATTCAGATGGGCAGCGAGAAGAACTTCTCTAGCCTTCACACCACCCTCTGTGCCACAGGAGGCGG
  GGCTTTCAAATTCGAAGAGGACTTCAGAATGATTGCTGACCTGCAGCTGCATAAACTGGATGAACTGGAC
  TGTCTGATTCAGGGCCTGCTTTATGTCGACTCTGTTGGCTTCAACGGCAAGCCAGAATGTTACTATTTTG
  AAAATCCCACAAATCCTGAATTGTGTCAAAAAAAGCCGTACTGCCTTGATAACCCATACCCTATGTTGCT
  GGTTAACATGGGCTCAGGTGTCAGCATTCTAGCCGTGTACTCCAAGGACAACTATAAAAGAGTTACAGGG
  ACCAGCTTTGGCAACATGATGAGTAAAGAAAAGCGAGATTCCATCAGCAAGGAAGACCTCGCCCGGGCCA
  CATTGGTCACCATCACCAACAACATTGGCTCCATTGCTCGGATGTGCGCGTTGAATGAGAACATAGACAG
  AGTTGTGTTTGTTGGAAATTTTCTCAGAATCAATATGGTCTCCATGAAGCTGCTGGCATATGCCATGGAT
  TTTTGGTCCAAAGGACAACTGAAAGCTCTGTTTTTGGAACATGAGGGTTATTTTGGAGCCGTTGGGGCAC
  TGTTGGAACTGTTCAAAATGACTGATGACAAGTAG
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_138316
• ORF Size: 945 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_138316.3, NP_612189.2
• RefSeq Size: 6021
• RefSeq ORF: 945
• Locus ID: 53354
• Protein Families: Druggable Genome
• Protein Pathways: Metabolic pathways, Pantothenate and CoA biosynthesis
• Gene Summary: This gene encodes a member of the pantothenate kinase family. Pantothenate kinases are key regulatory enzymes in the biosynthesis of coenzyme A (CoA). The encoded protein catalyzes the first and rate-limiting enzymatic reaction in CoA biosynthesis and is regulated by CoA through feedback inhibition. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. This gene and an intronic miRNA on the same strand are co-regulated by the tumor suppressor p53 (see PMID 20833636). [provided by RefSeq, Apr 2011]
  Transcript Variant: This variant (gamma) differs in the 5' UTR, lacks a portion of the 5' coding region and an internal coding exon, and initiates translation at an alternate start codon, compared to variant alpha. The encoded isoform (gamma) has a distinct N-terminus and is shorter than isoform alpha. Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments.