TSLP (NM_138551) Human Untagged Clone

CAT#: SC306036

TSLP (untagged)-Human thymic stromal lymphopoietin (TSLP), transcript variant 2


  "NM_138551" in other vectors (7)

Reconstitution Protocol

USD 420.00

In Stock*

Size
    • 10 ug

Product Images

Other products for "TSLP"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol TSLP
Synonyms thymic stromal lymphopoietin
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>OriGene sequence for NM_138551 edited
GGGGGACTCTCGACTTGTGTTCCCCGCTCCTCCCTGACCTTCCTCCCCTCCCCTTTCACT
CAATTCTCACCAACTCTTTCTCTCTCTGGTGTTTTCTCCTTTTCTCGTAAACTTTGCCGC
CTATGAGCAGCCACATTGCCTTACTGAAATCCAGAGCCTAACCTTCAATCCCACCGCCGG
CTGCGCGTCGCTCGCCAAAGAAACGTTCGCCATGAAAACTAAGGCTGCCTTAGCTATCTG
GTGCCCAGGCTATTCGGAAACTCAGATAAATGCTACTCAGGCAATGAAGAAGAGGAGAAA
AAGGAAAGTCACAACCAATAAATGTCTGGAACAAGTGTCACAATTACAAGGATTGTGGCG
TCGCTTCAATCGACCTTTACTGAAACAACAGTAAACCATCTTTATTATGGTCATATTTCA
CAGCACCAAAATAAATCATCTTTATTAAGTAGATGAAACATTAACTCTAACTGTGACAAA
GAAGACCACAAATAGTTATCTTTTAATTACAGAAGAGTTTCTTAACTTACTTTTGTAAGT
TTTTATTGTGTAAGTTTATAATGCAGGGGAAGTACTACTCCTCAAATGTTGAGGGAAGCT
TCCATAACATTGATGACTGGCTTCATGGCAGTAATTCTCGGCTGTAGTTGCATAAGCATT
GCTCAAGAGGAAAATCCAAAAGTGCAGCAGGAGAACTTTTTTCCCTGAAAAAGGAAAAAT
ATTGAACTCAATGATAGCACCTAAACTTACATTTAAAAGACAGACATTCCTTCTACATGT
AATGACACTTCTTGTGTTAAACTAAAAATTTACAAGAGAAGAAAGTGAAAGCAAATGGGG
TTTCACAAATAGTTGTAAATATAGTGAAGCAATTTGAAATAATTTTCAAGCAAAGTATTG
TGAAAGTATTCTAAGCCAAGTTTTAAATATTATCTAACAGACAAGAGTGGTATATACAAG
TAGATCCTGAGAAGTACCTTTGTTACAGCTACTATAAATATACATATAAATTATAGAATC
TACTTTAATTTATTTTGTGAACACTTTTGAAAATGTACATGTTCCTTTGTAATTGACACT
ATATATTTCTTAATAAAATAATTCCCAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
Restriction Sites Please inquire     
ACCN NM_138551
ORF Size 183 bp
Insert Size 1100
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Reference Data
RefSeq NM_138551.2, NP_612561.1
RefSeq Size 2411
RefSeq ORF 183
Locus ID 85480
Protein Families Druggable Genome
Protein Pathways Cytokine-cytokine receptor interaction, Jak-STAT signaling pathway
Gene Summary This gene encodes a hemopoietic cytokine proposed to signal through a heterodimeric receptor complex composed of the thymic stromal lymphopoietin receptor and the IL-7R alpha chain. It mainly impacts myeloid cells and induces the release of T cell-attracting chemokines from monocytes and enhances the maturation of CD11c(+) dendritic cells. The protein promotes T helper type 2 (TH2) cell responses that are associated with immunity in various inflammatory diseases, including asthma, allergic inflammation and chronic obstructive pulmonary disease. The protein is therefore considered a potential therapeutic target for the treatment of such diseases. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Jan 2012]
Transcript Variant: This variant (2, also known as sfTSLP) lacks two 5' exons but contains an alternate 5' exon, differs in the 5' UTR, and uses a downstream in-frame start codon, compared to variant 1. The encoded isoform (2) is shorter at the N-terminus, compared to isoform 1. This is the predominant isoform, and it exhibits a much stronger antimicrobial activity compared to the longer isoform lfTSLP (PMID:24850429).

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.