Kallikrein 15 (KLK15) (NM_138564) Human Untagged Clone

CAT#: SC306039

KLK15 (untagged)-Human kallikrein-related peptidase 15 (KLK15), transcript variant 3

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: KLK15
• Synonyms: ACO; HSRNASPH
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_138564, the custom clone sequence may differ by one or more nucleotides
  ATGTGGCTTCTCCTCACTCTCTCCTTCCTGCTGGCATCCACAGCAGCCCAGGATGGTGAC
  AAGTTGCTGGAAGGTGACGAGTGTGCACCCCACTCCCAGCCATGGCAAGTGGCTCTCTAC
  GAGCGTGGACGCTTTAACTGTGGCGCTTCCCTCATCTCCCCACACTGGGTGCTGTCTGCG
  GCCCACTGCCAAAGCCGCTTCATGAGAGTGCGCCTGGGAGAGCACAACCTGCGCAAGCGC
  GATGGCCCAGAGCAACTACGGACCACGTCTCGGGTCATTCCACACCCGCGCTACGAAGCG
  CGCAGCCACCGCAACGACATCATGTTGCTGCGCCTAGTCCAGCCCGCACGCCTGAACCCC
  CAGGGTGACTCTGGGGGACCCCTGGTCTGTGGGGGCATCCTGCAGGGCATTGTGTCCTGG
  GGTGACGTCCCTTGTGACAACACCACCAAGCCTGGTGTCTATACCAAAGTCTGCCACTAC
  TTGGAGTGGATCAGGGAAACCATGAAGAGGAACTGA
  
• Restriction Sites: Please inquire
• ACCN: NM_138564
• ORF Size: 516 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_138564.1, NP_612631.1
• RefSeq Size: 1054
• RefSeq ORF: 516
• Locus ID: 55554
• Protein Families: Druggable Genome, Protease, Secreted Protein
• Gene Summary: Kallikreins are a subgroup of serine proteases having diverse physiological functions. Growing evidence suggests that many kallikreins are implicated in carcinogenesis and some have potential as novel cancer and other disease biomarkers. This gene is one of the fifteen kallikrein subfamily members located in a cluster on chromosome 19. In prostate cancer, this gene has increased expression, which indicates its possible use as a diagnostic or prognostic marker for prostate cancer. The gene contains multiple polyadenylation sites and alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Jul 2008]
  Transcript Variant: This variant (3) uses an alternate splice site on an internal exon and lacks an alternate exon, compared to variant 4. The missing internal segment results in an encoded isoform (3) that lacks an internal region, but shares the same N- and C-termini, compared to isoform 4.