CD200R (CD200R1) (NM_138940) Human Untagged Clone

CAT#: SC306094

CD200R1 (untagged)-Human CD200 receptor 1 (CD200R1), transcript variant 3

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: CD200R1
• Synonyms: CD200R; HCRTR2; MOX2R; OX2R
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_138940, the custom clone sequence may differ by one or more nucleotides
  ATGCTCTGCCCTTGGAGAACTGCTAACCTAGGGCTACTGTTGATTTTGACTATCTTCTTA
  GTGGCCGCTTCAAGCAGTTTATGTATGGATGAAAAACAGATTACACAGAACTACTCGAAA
  GTACTCGCAGAAGTTAACACTTCATGGCCTGTAAAGATGGCTACAAATGCTGTGCTTTGT
  TGCCCTCCTATCGCATTAAGAAATTTGATCATAATAACATGGGAAATAATCCTGAGAGGC
  CAGCCTTCCTGCACAAAAGCCTACAAGAAAGAAACAAATGAGACCAAGGAAACCAACTGT
  ACTGATGAGAGAATAACCTGGGTCTCCAGACCTGATCAGAATTCGGACCTTCAGATTCGT
  ACCGTGGCCATCACTCATGACGGGTATTACAGATGCATAATGGTAACACCTGATGGGAAT
  TTCCATCGTGGATATCACCTCCAAGTGTTAGGTAAGGAGCATCATATATTGAGGTATTTC
  ACATCACCAGATTTGTGA
  
• Restriction Sites: Please inquire
• ACCN: NM_138940
• ORF Size: 498 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_138940.2, NP_620386.1
• RefSeq Size: 956
• RefSeq ORF: 498
• Locus ID: 131450
• Protein Families: Druggable Genome, Transmembrane
• Gene Summary: This gene encodes a receptor for the OX-2 membrane glycoprotein. Both the receptor and substrate are cell surface glycoproteins containing two immunoglobulin-like domains. This receptor is restricted to the surfaces of myeloid lineage cells and the receptor-substrate interaction may function as a myeloid downregulatory signal. Mouse studies of a related gene suggest that this interaction may control myeloid function in a tissue-specific manner. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Jul 2008]
  Transcript Variant: This variant (3) contains multiple differences in the coding region, compared to variant 1. This results in a frameshift and early stop codon, as well as loss of an immunoglobulin and transmembrane domain in the protein (isoform c), compared to isoform a.