NY-ESO-1 (CTAG1A) (NM_139250) Human Untagged Clone
CAT#: SC306136
CTAG1A (untagged)-Human cancer/testis antigen 1A (CTAG1A)
"NM_139250" in other vectors (6)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | CTAG1A |
Synonyms | CT6.1; ESO1; LAGE-2; LAGE2A; NY-ESO-1 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_139250, the custom clone sequence may differ by one or more nucleotides
ATGCAGGCCGAAGGCCGGGGCACAGGGGGTTCGACGGGCGATGCTGATGGCCCAGGAGGCCCTGGCATTC CTGATGGCCCAGGGGGCAATGCTGGCGGCCCAGGAGAGGCGGGTGCCACGGGCGGCAGAGGTCCCCGGGG CGCAGGGGCAGCAAGGGCCTCGGGGCCGGGAGGAGGCGCCCCGCGGGGTCCGCATGGCGGCGCGGCTTCA GGGCTGAATGGATGCTGCAGATGCGGGGCCAGGGGGCCGGAGAGCCGCCTGCTTGAGTTCTACCTCGCCA TGCCTTTCGCGACACCCATGGAAGCAGAGCTGGCCCGCAGGAGCCTGGCCCAGGATGCCCCACCGCTTCC CGTGCCAGGGGTGCTTCTGAAGGAGTTCACTGTGTCCGGCAACATACTGACTATCCGACTGACTGCTGCA GACCACCGCCAACTGCAGCTCTCCATCAGCTCCTGTCTCCAGCAGCTTTCCCTGTTGATGTGGATCACGC AGTGCTTTCTGCCCGTGTTTTTGGCTCAGCCTCCCTCAGGGCAGAGGCGCTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_139250 |
ORF Size | 543 bp |
OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Reference Data | |
RefSeq | NM_139250.1, NP_640343.1 |
RefSeq Size | 748 |
RefSeq ORF | 543 |
Locus ID | 246100 |
Protein Families | Druggable Genome |
Gene Summary | The protein encoded by this gene is a tumor cell antigen found in various types of cancers, which makes it a good candidate for a cancer vaccine. This gene is also highly expressed in normal ovary and testis tissues. An identical copy of this gene is found on the same chromosome. [provided by RefSeq, Dec 2015] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC216285 | CTAG1A (Myc-DDK-tagged)-Human cancer/testis antigen 1A (CTAG1A) |
USD 98.00 |
|
RG216285 | CTAG1A (GFP-tagged) - Human cancer/testis antigen 1A (CTAG1A) |
USD 460.00 |
|
RC216285L1 | Lenti ORF clone of Human cancer/testis antigen 1A (CTAG1A), Myc-DDK-tagged |
USD 768.00 |
|
RC216285L2 | Lenti ORF clone of Human cancer/testis antigen 1A (CTAG1A), mGFP tagged |
USD 620.00 |
|
RC216285L3 | Lenti ORF clone of Human cancer/testis antigen 1A (CTAG1A), Myc-DDK-tagged |
USD 620.00 |
|
RC216285L4 | Lenti ORF clone of Human cancer/testis antigen 1A (CTAG1A), mGFP tagged |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review