APOBEC3A (NM_145699) Human Untagged Clone

CAT#: SC306262

APOBEC3A (untagged)-Human apolipoprotein B mRNA editing enzyme, catalytic polypeptide-like 3A (APOBEC3A), transcript variant 1

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: APOBEC3A
• Synonyms: A3A; ARP3; bK150C2.1; PHRBN
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_145699, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGAAGCCAGCCCAGCATCCGGGCCCAGACACTTGATGGATCCACACATATTCACTTCCAACTTTAACA
  ATGGCATTGGAAGGCATAAGACCTACCTGTGCTACGAAGTGGAGCGCCTGGACAATGGCACCTCGGTCAA
  GATGGACCAGCACAGGGGCTTTCTACACAACCAGGCTAAGAATCTTCTCTGTGGCTTTTACGGCCGCCAT
  GCGGAGCTGCGCTTCTTGGACCTGGTTCCTTCTTTGCAGTTGGACCCGGCCCAGATCTACAGGGTCACTT
  GGTTCATCTCCTGGAGCCCCTGCTTCTCCTGGGGCTGTGCCGGGGAAGTGCGTGCGTTCCTTCAGGAGAA
  CACACACGTGAGACTGCGTATCTTCGCTGCCCGCATCTATGATTACGACCCCCTATATAAGGAGGCACTG
  CAAATGCTGCGGGATGCTGGGGCCCAAGTCTCCATCATGACCTACGATGAATTTAAGCACTGCTGGGACA
  CCTTTGTGGACCACCAGGGATGTCCCTTCCAGCCCTGGGATGGACTAGATGAGCACAGCCAAGCCCTGAG
  TGGGAGGCTGCGGGCCATTCTCCAGAATCAGGGAAACTGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_145699
• ORF Size: 600 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_145699.3, NP_663745.1
• RefSeq Size: 1444
• RefSeq ORF: 600
• Locus ID: 200315
• Gene Summary: This gene is a member of the cytidine deaminase gene family. It is one of seven related genes or pseudogenes found in a cluster, thought to result from gene duplication, on chromosome 22. Members of the cluster encode proteins that are structurally and functionally related to the C to U RNA-editing cytidine deaminase APOBEC1. The protein encoded by this gene lacks the zinc binding activity of other family members. The protein plays a role in immunity, by restricting transmission of foreign DNA such as viruses. One mechanism of foreign DNA restriction is deamination of foreign double-stranded DNA cytidines to uridines, which leads to DNA degradation. However, other mechanisms are also thought to be involved, as anti-viral effect is not dependent on deaminase activity. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2012]
  Transcript Variant: This variant (1) represents the longer transcript and encodes the longer isoform (a).