ASB4 (NM_145872) Human Untagged Clone
CAT#: SC306284
ASB4 (untagged)-Human ankyrin repeat and SOCS box containing 4 (ASB4), transcript variant 2
"NM_145872" in other vectors (4)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | ASB4 |
Synonyms | ASB-4 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_145872, the custom clone sequence may differ by one or more nucleotides
ATGGACGGCACCACTGCCCCTGTCACTAAATCTGGAGCTGCCAAGTTAGTTAAGAGAAATTTCCTTGAGG CGCTAAAGTCCAATGACTTCGGAAAATTGAAGGCTATTTTGATCCAAAGGCAAATAGATGTGGACACTGT TTTTGAAGTCGAAGATGAGAATATGGTTTTGGCATCTTATAAACAAGGTTACTGGTTGCCTAGCTATAAA TTGAAGTCTTCCTGGGCCACAGGCCTCCATCTCTCTGTCTTGTTTGGCCATGTGGAATGTCTTCTGGTGC TACTGGACCACAATGCTACAATCAACTGTAGACCCAATGGGAAAACCCCTCTTCACGTGGCTTGTGAAAT GGCCAATGTGGATTGTGTTAAGATCCTCTGTGATCGTGGGGCAAAGCTCAATTGCTACTCCTTAAGTGGA CACACAGCTTTGCACTTTTGTACAACTCCAAGTTCCATTCTCTGTGCCAAGCAATTGGTTTGGAGAGGGG CGAATGTGAACATGAAGACCAACAACCAAGATGAGGAGACGCCCTTGCACACGGCTGCCCACTTCGGCCT TTCGGAGCTGGTGGCCTTCTACGTGGAACACGGGGCCATAGTGGACAGCGTGAATGCCCACATGGAGACC CCCCTGGCCATCGCCGCCTACTGGGCCCTCCGCTTTAAGGAGCAGGAGTACAGCACGGAGCACCACCTGG TCTGCCGCATGCTGCTTGACTACAAAGCCGAAGTCAATGCCCGAGATGACGACTTTAAATCTCCCCTCCA CAAGGCAGCCTGGAACTGTGACCACGTGCTCATGCACATGATGCTGGAAGCTGGCGCCGAAGCCAATCTC ATGGATATCAACGGCTGTGCTGCCATCCAGTACGTGCTGAAGGTCACCTCCGTGCGCCCTGCTGCCCAGC CTGAGATCTGCTACCAGCTCCTGTTGAACCATGGGGCTGCCCGAATATACCCTCCACAGTTCCATAAGGT GAGGCTCTGCCCAGTGGTCAGCAGGTTGAGGAAGATTCAAATGGCAGCCTTGTCTGAAATCTCCAAGTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_145872 |
ORF Size | 1050 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Reference Data | |
RefSeq | NM_145872.2, NP_665879.1 |
RefSeq Size | 1565 |
RefSeq ORF | 1050 |
Locus ID | 51666 |
Protein Families | Druggable Genome |
Gene Summary | The protein encoded by this gene is a member of the ankyrin repeat and SOCS box-containing (ASB) family of proteins. They contain ankyrin repeat sequence and SOCS box domain. The SOCS box serves to couple suppressor of cytokine signalling (SOCS) proteins and their binding partners with the elongin B and C complex, possibly targeting them for degradation. Multiple alternatively spliced transcript variants have been described for this gene but some of the full length sequences are not known. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (2) uses an alternate splice site in the 3' coding region, compared to variant 1, that results in a frameshift. It encodes isoform b which has a shorter and distinct C-terminus which lacks a SOCS box domain compared to isoform a. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC224451 | ASB4 (Myc-DDK-tagged)-Human ankyrin repeat and SOCS box containing 4 (ASB4), transcript variant 2 |
USD 420.00 |
|
RG224451 | ASB4 (GFP-tagged) - Human ankyrin repeat and SOCS box containing 4 (ASB4), transcript variant 2 |
USD 460.00 |
|
RC224451L3 | Lenti ORF clone of Human ankyrin repeat and SOCS box containing 4 (ASB4), transcript variant 2, Myc-DDK-tagged |
USD 620.00 |
|
RC224451L4 | Lenti ORF clone of Human ankyrin repeat and SOCS box containing 4 (ASB4), transcript variant 2, mGFP tagged |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review