ASB4 (NM_145872) Human Untagged Clone

CAT#: SC306284

ASB4 (untagged)-Human ankyrin repeat and SOCS box containing 4 (ASB4), transcript variant 2


  "NM_145872" in other vectors (4)

Reconstitution Protocol

USD 600.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "ASB4"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol ASB4
Synonyms ASB-4
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_145872, the custom clone sequence may differ by one or more nucleotides


ATGGACGGCACCACTGCCCCTGTCACTAAATCTGGAGCTGCCAAGTTAGTTAAGAGAAATTTCCTTGAGG
CGCTAAAGTCCAATGACTTCGGAAAATTGAAGGCTATTTTGATCCAAAGGCAAATAGATGTGGACACTGT
TTTTGAAGTCGAAGATGAGAATATGGTTTTGGCATCTTATAAACAAGGTTACTGGTTGCCTAGCTATAAA
TTGAAGTCTTCCTGGGCCACAGGCCTCCATCTCTCTGTCTTGTTTGGCCATGTGGAATGTCTTCTGGTGC
TACTGGACCACAATGCTACAATCAACTGTAGACCCAATGGGAAAACCCCTCTTCACGTGGCTTGTGAAAT
GGCCAATGTGGATTGTGTTAAGATCCTCTGTGATCGTGGGGCAAAGCTCAATTGCTACTCCTTAAGTGGA
CACACAGCTTTGCACTTTTGTACAACTCCAAGTTCCATTCTCTGTGCCAAGCAATTGGTTTGGAGAGGGG
CGAATGTGAACATGAAGACCAACAACCAAGATGAGGAGACGCCCTTGCACACGGCTGCCCACTTCGGCCT
TTCGGAGCTGGTGGCCTTCTACGTGGAACACGGGGCCATAGTGGACAGCGTGAATGCCCACATGGAGACC
CCCCTGGCCATCGCCGCCTACTGGGCCCTCCGCTTTAAGGAGCAGGAGTACAGCACGGAGCACCACCTGG
TCTGCCGCATGCTGCTTGACTACAAAGCCGAAGTCAATGCCCGAGATGACGACTTTAAATCTCCCCTCCA
CAAGGCAGCCTGGAACTGTGACCACGTGCTCATGCACATGATGCTGGAAGCTGGCGCCGAAGCCAATCTC
ATGGATATCAACGGCTGTGCTGCCATCCAGTACGTGCTGAAGGTCACCTCCGTGCGCCCTGCTGCCCAGC
CTGAGATCTGCTACCAGCTCCTGTTGAACCATGGGGCTGCCCGAATATACCCTCCACAGTTCCATAAGGT
GAGGCTCTGCCCAGTGGTCAGCAGGTTGAGGAAGATTCAAATGGCAGCCTTGTCTGAAATCTCCAAGTAA


Restriction Sites SgfI-MluI     
ACCN NM_145872
ORF Size 1050 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Reference Data
RefSeq NM_145872.2, NP_665879.1
RefSeq Size 1565
RefSeq ORF 1050
Locus ID 51666
Protein Families Druggable Genome
Gene Summary The protein encoded by this gene is a member of the ankyrin repeat and SOCS box-containing (ASB) family of proteins. They contain ankyrin repeat sequence and SOCS box domain. The SOCS box serves to couple suppressor of cytokine signalling (SOCS) proteins and their binding partners with the elongin B and C complex, possibly targeting them for degradation. Multiple alternatively spliced transcript variants have been described for this gene but some of the full length sequences are not known. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (2) uses an alternate splice site in the 3' coding region, compared to variant 1, that results in a frameshift. It encodes isoform b which has a shorter and distinct C-terminus which lacks a SOCS box domain compared to isoform a.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.