PFDN5 (NM_145897) Human Untagged Clone

CAT#: SC306290

PFDN5 (untagged)-Human prefoldin subunit 5 (PFDN5), transcript variant 3


  "NM_145897" in other vectors (4)

Reconstitution Protocol

USD 420.00

2 Weeks*

Size
    • 10 ug

Product Images

Other products for "PFDN5"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol PFDN5
Synonyms MM-1; MM1; PFD5
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_145897, the custom clone sequence may differ by one or more nucleotides
ATGGCGCAGTCTATTAACATCACGGAGCTGAATCTGCCGCAGCTAGAAATGCTCAAGAAC
CAGCTGGACCAGATGTATGTCCCTGGGAAGCTGCATGATGTGGAACACGTGCTCATCGAT
GTGGGAACTGGGTACTATGTAGAGAAGACAGCTGAGGATGCCAAGGACTTCTTCAAGAGG
AAGATAGATTTTCTAACCAAGCAGATGGAGAAAATCCAACCAGCTCTTCAGGAGAAGCAC
GCCATGAAACAGGCCGTCATGGAAATGATGAGTCAGAAGATTCAGCAGCTCACAGCCCTG
GGGGCAGCTCAGGCTACTGCTAAGGCCTGA
Restriction Sites Please inquire     
ACCN NM_145897
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_145897.1, NP_665904.1
RefSeq Size 526 bp
RefSeq ORF 330 bp
Locus ID 5204
Cytogenetics 12q13.13
Protein Families Transcription Factors
Gene Summary 'This gene encodes a member of the prefoldin alpha subunit family. The encoded protein is one of six subunits of prefoldin, a molecular chaperone complex that binds and stabilizes newly synthesized polypeptides, thereby allowing them to fold correctly. The complex, consisting of two alpha and four beta subunits, forms a double beta barrel assembly with six protruding coiled-coils. The encoded protein may also repress the transcriptional activity of the proto-oncogene c-Myc. Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, Jul 2008]'
Transcript Variant: This variant (3) lacks two exons in the coding region but maintains the reading frame, compared to variant 1. The encoded protein (isoform gamma) is shorter than isoform alpha.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.