Macrophage Inflammatory Protein 3 (CCL23) (NM_145898) Human Untagged Clone

CAT#: SC306291

CCL23 (untagged)-Human chemokine (C-C motif) ligand 23 (CCL23), transcript variant CKbeta8

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: CCL23
• Synonyms: CK-BETA-8; Ckb-8; Ckb-8-1; CKb8; hmrp-2a; MIP-3; MIP3; MPIF-1; SCYA23
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_145898, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGAAGGTCTCCGTGGCTGCCCTCTCCTGCCTCATGCTTGTTACTGCCCTTGGATCCCAGGCCCGGGTCA
  CAAAAGATGCAGAGACAGAGTTCATGATGTCAAAGCTTCCATTGGAAAATCCAGTACTTCTGGACAGATT
  CCATGCTACTAGTGCTGACTGCTGCATCTCCTACACCCCACGAAGCATCCCGTGTTCACTCCTGGAGAGT
  TACTTTGAAACGAACAGCGAGTGCTCCAAGCCGGGTGTCATCTTCCTCACCAAGAAGGGGCGACGTTTCT
  GTGCCAACCCCAGTGATAAGCAAGTTCAGGTTTGCATGAGAATGCTGAAGCTGGACACACGGATCAAGAC
  CAGGAAGAATTGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_145898
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_145898.3, NP_665905.2
• RefSeq Size: 604 bp
• RefSeq ORF: 363 bp
• Locus ID: 6368
• Cytogenetics: 17q12
• Protein Families: Druggable Genome, Secreted Protein
• Protein Pathways: Chemokine signaling pathway, Cytokine-cytokine receptor interaction
• Gene Summary: 'This gene is one of several chemokine genes clustered on the q-arm of chromosome 17. Chemokines form a superfamily of secreted proteins involved in immunoregulatory and inflammatory processes. The superfamily is divided into four subfamilies based on the arrangement of the N-terminal cysteine residues of the mature peptide. This chemokine, a member of the CC subfamily, displays chemotactic activity on resting T lymphocytes and monocytes, lower activity on neutrophils and no activity on activated T lymphocytes. The protein is also a strong suppressor of colony formation by a multipotential hematopoietic progenitor cell line. In addition, the product of this gene is a potent agonist of the chemokine (C-C motif) receptor 1. Alternative splicing results in multiple transcript variants that encode different isoforms. [provided by RefSeq, Jul 2013]'
  Transcript Variant: This variant (CKbeta8) uses an alternate, in-frame splice site in the coding region, compared to transcript variant CKbeta8-1. This difference results in a shorter protein (isoform CKbeta8) compared to isoform CKbeta8-1.