KCNIP4 (NM_147182) Human Untagged Clone
CAT#: SC306302
KCNIP4 (untagged)-Human Kv channel interacting protein 4 (KCNIP4), transcript variant 3
"NM_147182" in other vectors (4)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | KCNIP4 |
Synonyms | CALP; KCHIP4 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_147182, the custom clone sequence may differ by one or more nucleotides
ATGGCCACCGTCAGGCATCGGCCTGAAGCCCTTGAGCTTCTGGAAGCCCAGAGCAAATTTACCAAGAAAG AGCTTCAGATCCTTTACAGAGGATTTAAGAATGAATGCCCCAGTGGTGTTGTTAATGAAGAAACCTTCAA AGAGATTTACTCGCAGTTCTTTCCACAGGGAGACTCTACAACATATGCACATTTTCTGTTCAATGCATTT GATACAGACCACAATGGAGCTGTGAGTTTCGAGGATTTCATCAAAGGTCTTTCCATTTTGCTCCGGGGGA CAGTACAAGAAAAACTCAATTGGGCATTTAATCTGTATGACATAAATAAAGATGGCTACATCACTAAAGA GGAAATGCTTGATATAATGAAAGCAATATACGATATGATGGGTAAATGTACATATCCTGTCCTCAAAGAA GATGCTCCCAGACAACACGTTGAAACATTTTTTCAGAAAATGGACAAAAATAAAGATGGGGTTGTTACCA TAGATGAGTTCATTGAAAGCTGCCAAAAAGATGAAAACATAATGCGCTCCATGCAGCTCTTTGAAAATGT GATTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_147182 |
ORF Size | 567 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Reference Data | |
RefSeq | NM_147182.3, NP_671711.1 |
RefSeq Size | 2371 |
RefSeq ORF | 567 |
Locus ID | 80333 |
Protein Families | Druggable Genome, Ion Channels: Other |
Gene Summary | This gene encodes a member of the family of voltage-gated potassium (Kv) channel-interacting proteins (KCNIPs), which belong to the recoverin branch of the EF-hand superfamily. Members of the KCNIP family are small calcium binding proteins. They all have EF-hand-like domains, and differ from each other in the N-terminus. They are integral subunit components of native Kv4 channel complexes. They may regulate A-type currents, and hence neuronal excitability, in response to changes in intracellular calcium. This protein member also interacts with presenilin. Multiple alternatively spliced transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (3) has an alternate exon which lacks an in-frame start codon, as compared to variant 1. Use of a downstream start codon results in an isoform (3, also known as KCHIP4.3) that has a shorter N-terminus, as compared to isoform 1. Variants 3 and 6 encode the same isoform (3). |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC216528 | KCNIP4 (Myc-DDK-tagged)-Human Kv channel interacting protein 4 (KCNIP4), transcript variant 3 |
USD 98.00 |
|
RG216528 | KCNIP4 (GFP-tagged) - Human Kv channel interacting protein 4 (KCNIP4), transcript variant 3 |
USD 460.00 |
|
RC216528L3 | Lenti ORF clone of Human Kv channel interacting protein 4 (KCNIP4), transcript variant 3, Myc-DDK-tagged |
USD 620.00 |
|
RC216528L4 | Lenti ORF clone of Human Kv channel interacting protein 4 (KCNIP4), transcript variant 3, mGFP tagged |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review