KCNIP4 (NM_147182) Human Untagged Clone

CAT#: SC306302

KCNIP4 (untagged)-Human Kv channel interacting protein 4 (KCNIP4), transcript variant 3


  "NM_147182" in other vectors (4)

Reconstitution Protocol

USD 420.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "KCNIP4"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol KCNIP4
Synonyms CALP; KCHIP4
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_147182, the custom clone sequence may differ by one or more nucleotides


ATGGCCACCGTCAGGCATCGGCCTGAAGCCCTTGAGCTTCTGGAAGCCCAGAGCAAATTTACCAAGAAAG
AGCTTCAGATCCTTTACAGAGGATTTAAGAATGAATGCCCCAGTGGTGTTGTTAATGAAGAAACCTTCAA
AGAGATTTACTCGCAGTTCTTTCCACAGGGAGACTCTACAACATATGCACATTTTCTGTTCAATGCATTT
GATACAGACCACAATGGAGCTGTGAGTTTCGAGGATTTCATCAAAGGTCTTTCCATTTTGCTCCGGGGGA
CAGTACAAGAAAAACTCAATTGGGCATTTAATCTGTATGACATAAATAAAGATGGCTACATCACTAAAGA
GGAAATGCTTGATATAATGAAAGCAATATACGATATGATGGGTAAATGTACATATCCTGTCCTCAAAGAA
GATGCTCCCAGACAACACGTTGAAACATTTTTTCAGAAAATGGACAAAAATAAAGATGGGGTTGTTACCA
TAGATGAGTTCATTGAAAGCTGCCAAAAAGATGAAAACATAATGCGCTCCATGCAGCTCTTTGAAAATGT
GATTTAA


Restriction Sites SgfI-MluI     
ACCN NM_147182
ORF Size 567 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Reference Data
RefSeq NM_147182.3, NP_671711.1
RefSeq Size 2371
RefSeq ORF 567
Locus ID 80333
Protein Families Druggable Genome, Ion Channels: Other
Gene Summary This gene encodes a member of the family of voltage-gated potassium (Kv) channel-interacting proteins (KCNIPs), which belong to the recoverin branch of the EF-hand superfamily. Members of the KCNIP family are small calcium binding proteins. They all have EF-hand-like domains, and differ from each other in the N-terminus. They are integral subunit components of native Kv4 channel complexes. They may regulate A-type currents, and hence neuronal excitability, in response to changes in intracellular calcium. This protein member also interacts with presenilin. Multiple alternatively spliced transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (3) has an alternate exon which lacks an in-frame start codon, as compared to variant 1. Use of a downstream start codon results in an isoform (3, also known as KCHIP4.3) that has a shorter N-terminus, as compared to isoform 1. Variants 3 and 6 encode the same isoform (3).

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.