TIRAP (NM_148910) Human Untagged Clone

CAT#: SC306331

TIRAP (untagged)-Human toll-interleukin 1 receptor (TIR) domain containing adaptor protein (TIRAP), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: TIRAP
• Synonyms: BACTS1; Mal; MyD88-2; wyatt
• Vector: pCMV6-XL5
• E. coli Selection: Ampicillin (100 ug/mL)
• Mammalian Cell Selection: None
• Sequence Data:
  Fully Sequenced ORF

  >OriGene ORF sequence for NM_148910 edited
  ATGGCATCATCGACCTCCCTCCCAGCTCCTGGCTCTCGGCCTAAGAAGCCTCTAGGCAAG
  ATGGCTGACTGGTTCAGGCAGACCCTGCTGAAGAAGCCCAAGAAGAGGCCCAACTCCCCA
  GAAAGCACCTCCAGCGATGCTTCACAGCCTACCTCACAGGACAGCCCACTACCCCCAAGC
  CTCAGCTCAGTCACGTCTCCCAGCCTGCCACCCACACATGCGAGTGACAGTGGCAGTAGT
  CGCTGGAGCAAAGACTATGACGTCTGCGTGTGCCACAGTGAGGAAGACCTGGTGGCCGCC
  CAGGACCTGGTCTCCTACTTGGAAGGCAGCACTGCCAGCCTGCGCTGCTTCCTGCAACTC
  CGGGATGCAACCCCAGGCGGCGCTATAGTGTCCGAGCTGTGCCAGGCACTGAGCAGTAGT
  CACTGCCGGGTGCTGCTCATCACGCCGGGCTTCCTTCAGGACCCCTGGTGCAAGTACCAG
  ATGCTGCAGGCCCTGACCGAGGCTCCAGGGGCCGAGGGCTGCACCATCCCCCTGCTGTCG
  GGCCTCAGCAGAGCTGCCTACCCACCTGAGCTCCGATTCATGTACTACGTCGATGGCAGG
  GGCCCTGATGGTGGCTTTCGTCAAGTCAAAGAAGCTGTCATGCGTTGTAAGCTACTACAG
  GAGGGAGAAGGGGAACGGGATTCAGCTACAGTATCTGATCTACTTTGA
  
• Restriction Sites: Please inquire
• ACCN: NM_148910
• ORF Size: 708 bp
• Insert Size: 2000
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_148910.1, NP_683708.1
• RefSeq Size: 1199
• RefSeq ORF: 708
• Locus ID: 114609
• Protein Families: Druggable Genome
• Protein Pathways: Toll-like receptor signaling pathway
• Gene Summary: The innate immune system recognizes microbial pathogens through Toll-like receptors (TLRs), which identify pathogen-associated molecular patterns. Different TLRs recognize different pathogen-associated molecular patterns and all TLRs have a Toll-interleukin 1 receptor (TIR) domain, which is responsible for signal transduction. The protein encoded by this gene is a TIR adaptor protein involved in the TLR4 signaling pathway of the immune system. It activates NF-kappa-B, MAPK1, MAPK3 and JNK, which then results in cytokine secretion and the inflammatory response. Alternative splicing of this gene results in several transcript variants; however, not all variants have been fully described. [provided by RefSeq, Jul 2008]
  Transcript Variant: This variant (2) has an additional segment within the 5' UTR and differs in the 3' coding region and 3' UTR, compared to variant 3. This results in a longer isoform (b) with a distinct C-terminus, compared to isoform a. Variants 2 and 4 both encode the same isoform (b).