CLDN19 (NM_148960) Human Untagged Clone

CAT#: SC306338

CLDN19 (untagged)-Human claudin 19 (CLDN19), transcript variant 1


  "NM_148960" in other vectors (6)

Reconstitution Protocol

USD 420.00

In Stock*

Size
    • 10 ug

Product Images

Other products for "CLDN19"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol CLDN19
Synonyms HOMG5
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>OriGene sequence for NM_148960 edited
CTGGCCATGACCAAAGCCCCTGCTGGCACCCTGGCCCAGCTCTGAGTCCTGGGACCCTCG
GTCCTCTCTCCTGGGCCATGGCCAACTCAGGCCTCCAGCTCCTGGGCTACTTCTTGGCCC
TGGGTGGCTGGGTGGGCATCATTGCTAGCACAGCCCTGCCACAGTGGAAGCAGTCTTCCT
ACGCAGGCGACGCCATCATCACTGCCGTGGGCCTCTATGAAGGGCTCTGGATGTCCTGCG
CCTCCCAGAGCACTGGGCAAGTGCAGTGCAAGCTCTACGACTCGCTGCTCGCCCTGGACG
GTCACATCCAATCAGCGCGGGCCCTGATGGTGGTGGCCGTGCTCCTGGGCTTCGTGGCCA
TGGTCCTCAGCGTAGTTGGCATGAAGTGTACGCGGGTGGGAGACAGCAACCCCATTGCCA
AGGGCCGTGTTGCCATCGCCGGGGGAGCCCTCTTCATCCTGGCAGGCCTCTGCACTTTGA
CTGCTGTCTCGTGGTATGCCACCCTGGTGACCCAGGAGTTCTTCAACCCAAGCACACCTG
TCAATGCCAGGTATGAATTTGGCCCAGCCCTGTTCGTGGGCTGGGCCTCAGCTGGCCTGG
CCGTGCTGGGCGGCTCCTTCCTCTGCTGCACATGCCCGGAGCCAGAGAGACCCAACAGCA
GCCCACAGCCCTATCGGCCTGGACCCTCTGCTGCTGCCCGAGAACCAGTTGTTAAATTGC
CCGCCTCCGCCAAGGGCCCCCTGGGTGTGTAATGTCCAGTCCCCAGCCAGGCTCTGTCCC
CTGCCATACCTAGACTGTGTGTTTCATATTTTTTTGGAAAGAGAAGTGAACATCCAGCCC
CAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
Restriction Sites Please inquire     
ACCN NM_148960
ORF Size 675 bp
Insert Size 700
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Reference Data
RefSeq NM_148960.1, NP_683763.1
RefSeq Size 2859
RefSeq ORF 675
Locus ID 149461
Protein Families Transmembrane
Protein Pathways Cell adhesion molecules (CAMs), Leukocyte transendothelial migration, Tight junction
Gene Summary The product of this gene belongs to the claudin family. It plays a major role in tight junction-specific obliteration of the intercellular space, through calcium-independent cell-adhesion activity. Defects in this gene are the cause of hypomagnesemia renal with ocular involvement (HOMGO). HOMGO is a progressive renal disease characterized by primary renal magnesium wasting with hypomagnesemia, hypercalciuria and nephrocalcinosis associated with severe ocular abnormalities such as bilateral chorioretinal scars, macular colobomata, significant myopia and nystagmus. Alternatively spliced transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jun 2010]
Transcript Variant: This variant (1) represents the shortest transcript, but encodes the longest isoform (a).

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.