PANK1 (NM_148978) Human Untagged Clone
CAT#: SC306350
PANK1 (untagged)-Human pantothenate kinase 1 (PANK1), transcript variant beta
"NM_148978" in other vectors (4)
Product Images
![](https://cdn.origene.com/img/defaults-img-expression-plasmids.jpg)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | PANK1 |
Synonyms | PANK |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_148978, the custom clone sequence may differ by one or more nucleotides
ATGAAGCTTATAAATGGCAAAAAGCAAACATTCCCATGGTTTGGCATGGACATCGGTGGAACGCTGGTTA AATTGGTGTATTTCGAGCCGAAGGATATTACAGCCGAAGAGGAGCAAGAGGAAGTGGAGAACCTGAAGAG CATCCGGAAGTATTTGACTTCTAATACTGCTTATGGGAAAACTGGGATCCGAGACGTCCACCTGGAACTG AAAAACCTGACCATGTGTGGACGCAAAGGGAACCTGCACTTCATCCGCTTTCCCAGCTGTGCTATGCACA GGTTCATTCAGATGGGCAGCGAGAAGAACTTCTCTAGCCTTCACACCACCCTCTGTGCCACAGGAGGCGG GGCTTTCAAATTCGAAGAGGACTTCAGAATGATTGCTGACCTGCAGCTGCATAAACTGGATGAACTGGAC TGTCTGATTCAGGGCCTGCTTTATGTCGACTCTGTTGGCTTCAACGGCAAGCCAGAATGTTACTATTTTG AAAATCCCACAAATCCTGAATTGTGTCAAAAAAAGCCGTACTGCCTTGATAACCCATACCCTATGTTGCT GGTTAACATGGGCTCAGGTGTCAGCATTCTAGCCGTGTACTCCAAGGACAACTATAAAAGAGTTACAGGG ACCAGTCTTGGAGGTGGAACATTCCTAGGCCTATGTTGCTTGCTGACTGGTTGTGAGACCTTTGAAGAAG CTCTGGAAATGGCAGCTAAAGGCGACAGCACCAATGTTGATAAACTGGTGAAGGACATTTACGGAGGAGA CTATGAACGATTTGGCCTTCAAGGATCTGCTGTAGCATCAAGCTTTGGCAACATGATGAGTAAAGAAAAG CGAGATTCCATCAGCAAGGAAGACCTCGCCCGGGCCACATTGGTCACCATCACCAACAACATTGGCTCCA TTGCTCGGATGTGCGCGTTGAATGAGAACATAGACAGAGTTGTGTTTGTTGGAAATTTTCTCAGAATCAA TATGGTCTCCATGAAGCTGCTGGCATATGCCATGGATTTTTGGTCCAAAGGACAACTGAAAGCTCTGTTT TTGGAACATGAGGGTTATTTTGGAGCCGTTGGGGCACTGTTGGAACTGTTCAAAATGACTGATGACAAGT AG |
Restriction Sites | SgfI-MluI |
ACCN | NM_148978 |
ORF Size | 1122 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Reference Data | |
RefSeq | NM_148978.2, NP_683879.1 |
RefSeq Size | 6198 |
RefSeq ORF | 1122 |
Locus ID | 53354 |
Protein Families | Druggable Genome |
Protein Pathways | Metabolic pathways, Pantothenate and CoA biosynthesis |
Gene Summary | This gene encodes a member of the pantothenate kinase family. Pantothenate kinases are key regulatory enzymes in the biosynthesis of coenzyme A (CoA). The encoded protein catalyzes the first and rate-limiting enzymatic reaction in CoA biosynthesis and is regulated by CoA through feedback inhibition. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. This gene and an intronic miRNA on the same strand are co-regulated by the tumor suppressor p53 (see PMID 20833636). [provided by RefSeq, Apr 2011] Transcript Variant: This variant (beta) differs in the 5' UTR, lacks a portion of the 5' coding region, and initiates translation at an alternate start codon, compared to variant alpha. The encoded isoform (beta) has a distinct N-terminus and is shorter than isoform alpha. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC212009 | PANK1 (Myc-DDK-tagged)-Human pantothenate kinase 1 (PANK1), transcript variant beta |
USD 98.00 |
|
RG212009 | PANK1 (GFP-tagged) - Human pantothenate kinase 1 (PANK1), transcript variant beta |
USD 460.00 |
|
RC212009L3 | Lenti-ORF clone of PANK1 (Myc-DDK-tagged)-Human pantothenate kinase 1 (PANK1), transcript variant beta |
USD 620.00 |
|
RC212009L4 | Lenti-ORF clone of PANK1 (mGFP-tagged)-Human pantothenate kinase 1 (PANK1), transcript variant beta |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review