PANK1 (NM_148978) Human Untagged Clone

CAT#: SC306350

PANK1 (untagged)-Human pantothenate kinase 1 (PANK1), transcript variant beta


  "NM_148978" in other vectors (4)

Reconstitution Protocol

USD 640.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "PANK1"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol PANK1
Synonyms PANK
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_148978, the custom clone sequence may differ by one or more nucleotides


ATGAAGCTTATAAATGGCAAAAAGCAAACATTCCCATGGTTTGGCATGGACATCGGTGGAACGCTGGTTA
AATTGGTGTATTTCGAGCCGAAGGATATTACAGCCGAAGAGGAGCAAGAGGAAGTGGAGAACCTGAAGAG
CATCCGGAAGTATTTGACTTCTAATACTGCTTATGGGAAAACTGGGATCCGAGACGTCCACCTGGAACTG
AAAAACCTGACCATGTGTGGACGCAAAGGGAACCTGCACTTCATCCGCTTTCCCAGCTGTGCTATGCACA
GGTTCATTCAGATGGGCAGCGAGAAGAACTTCTCTAGCCTTCACACCACCCTCTGTGCCACAGGAGGCGG
GGCTTTCAAATTCGAAGAGGACTTCAGAATGATTGCTGACCTGCAGCTGCATAAACTGGATGAACTGGAC
TGTCTGATTCAGGGCCTGCTTTATGTCGACTCTGTTGGCTTCAACGGCAAGCCAGAATGTTACTATTTTG
AAAATCCCACAAATCCTGAATTGTGTCAAAAAAAGCCGTACTGCCTTGATAACCCATACCCTATGTTGCT
GGTTAACATGGGCTCAGGTGTCAGCATTCTAGCCGTGTACTCCAAGGACAACTATAAAAGAGTTACAGGG
ACCAGTCTTGGAGGTGGAACATTCCTAGGCCTATGTTGCTTGCTGACTGGTTGTGAGACCTTTGAAGAAG
CTCTGGAAATGGCAGCTAAAGGCGACAGCACCAATGTTGATAAACTGGTGAAGGACATTTACGGAGGAGA
CTATGAACGATTTGGCCTTCAAGGATCTGCTGTAGCATCAAGCTTTGGCAACATGATGAGTAAAGAAAAG
CGAGATTCCATCAGCAAGGAAGACCTCGCCCGGGCCACATTGGTCACCATCACCAACAACATTGGCTCCA
TTGCTCGGATGTGCGCGTTGAATGAGAACATAGACAGAGTTGTGTTTGTTGGAAATTTTCTCAGAATCAA
TATGGTCTCCATGAAGCTGCTGGCATATGCCATGGATTTTTGGTCCAAAGGACAACTGAAAGCTCTGTTT
TTGGAACATGAGGGTTATTTTGGAGCCGTTGGGGCACTGTTGGAACTGTTCAAAATGACTGATGACAAGT
AG


Restriction Sites SgfI-MluI     
ACCN NM_148978
ORF Size 1122 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Reference Data
RefSeq NM_148978.2, NP_683879.1
RefSeq Size 6198
RefSeq ORF 1122
Locus ID 53354
Protein Families Druggable Genome
Protein Pathways Metabolic pathways, Pantothenate and CoA biosynthesis
Gene Summary This gene encodes a member of the pantothenate kinase family. Pantothenate kinases are key regulatory enzymes in the biosynthesis of coenzyme A (CoA). The encoded protein catalyzes the first and rate-limiting enzymatic reaction in CoA biosynthesis and is regulated by CoA through feedback inhibition. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. This gene and an intronic miRNA on the same strand are co-regulated by the tumor suppressor p53 (see PMID 20833636). [provided by RefSeq, Apr 2011]
Transcript Variant: This variant (beta) differs in the 5' UTR, lacks a portion of the 5' coding region, and initiates translation at an alternate start codon, compared to variant alpha. The encoded isoform (beta) has a distinct N-terminus and is shorter than isoform alpha. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.