CCDC108 (CFAP65) (NM_152389) Human Untagged Clone
CAT#: SC306385
CCDC108 (untagged)-Human coiled-coil domain containing 108 (CCDC108), transcript variant 2
"NM_152389" in other vectors (4)
Product Images
![](https://cdn.origene.com/img/defaults-img-expression-plasmids.jpg)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | CFAP65 |
Synonyms | CCDC108 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_152389, the custom clone sequence may differ by one or more nucleotides
ATGATGCTCACCCAGGCTCCAAGCTCCGTCGTGAGGTCCAGGAACAGCAGGAACCACACCGTGAACTCTG GTGGATCCTGCCTGAGTGCCAGCACAGTGGCCATCCCTGCCATCAACGACAGCAGTGCAGCCATGAGTGC CTGCAGCACCATCAGCGCCCAGCCCGCAAGCTCCATGGACACTCAGATGCACTCCCCAAAGAAGCAGGAG AGAGTGAACAAGAGGGTCATCTGGGGCATTGAGGTGGCTGAGGAGCTGCATTGGAAAGGCTGGGAGCTAG GAAAGGAGACCACAAGGAATCTGGTTCTGAAAAATCGATCCTTGAAACTCCAGAAGATGAAGTACAGGTA CCAGTATAAGGGATCAAGGACCCAGTGCCACAGCCTTGAGCCCCGAAAGCAGGCTCTCTTCAAAACAAAA CAAAACAAACAAAAAAAACCTTTAACATGCCATATAAAAGCCAGTGAGTGTTTAAAATACGTGCAGTATG AATAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_152389 |
ORF Size | 495 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Reference Data | |
RefSeq | NM_152389.3, NP_689602.2 |
RefSeq Size | 2318 |
RefSeq ORF | 495 |
Locus ID | 255101 |
Protein Families | Transmembrane |
Gene Summary | The protein encoded by this gene has putative coiled-coil domains and may be a transmembrane protein. The chicken ortholog of this gene is involved in the Rose-comb mutation, which is a large chromosome inversion, resulting in altered comb morphology and defects in sperm motility. [provided by RefSeq, Aug 2016] Transcript Variant: This variant (2) contains multiple differences in the UTRs and coding region, including the lack of multiple 3' coding exons, compared to variant 1. It initiates translation at a downstream in-frame start codon. The encoded isoform (2) is shorter than isoform 1 and has a shorter N-terminus and a distinct C-terminus. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC224874 | CCDC108 (Myc-DDK-tagged)-Human coiled-coil domain containing 108 (CCDC108), transcript variant 2 |
USD 420.00 |
|
RG224874 | CCDC108 (GFP-tagged) - Human coiled-coil domain containing 108 (CCDC108), transcript variant 2 |
USD 460.00 |
|
RC224874L3 | Lenti ORF clone of Human coiled-coil domain containing 108 (CCDC108), transcript variant 2, Myc-DDK-tagged |
USD 620.00 |
|
RC224874L4 | Lenti ORF clone of Human coiled-coil domain containing 108 (CCDC108), transcript variant 2, mGFP tagged |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review