DEFB123 (NM_153324) Human Untagged Clone

CAT#: SC306585

DEFB123 (untagged)-Human defensin, beta 123 (DEFB123)

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: DEFB123
• Synonyms: DEFB-23; DEFB23; ESC42-RELD
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_153324, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGAAGCTCCTTTTGCTGACTTTGACTGTGCTGCTGCTCTTATCCCAGCTGACTCCAGGTGGCACCCAAA
  GATGCTGGAATCTTTATGGCAAATGCCGTTACAGATGCTCCAAGAAGGAAAGAGTCTATGTTTACTGCAT
  AAATAATAAAATGTGCTGCGTGAAGCCCAAGTACCAGCCAAAAGAAAGGTGGTGGCCATTTTAA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_153324
• ORF Size: 204 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_153324.3, NP_697019.1
• RefSeq Size: 481
• RefSeq ORF: 204
• Locus ID: 245936
• Protein Families: Secreted Protein
• Gene Summary: Defensins are cysteine-rich cationic polypeptides that are important in the host immunologic response to invading microorganisms. This antimicrobial protein is secreted and is a member of the beta defensin protein family. Beta defensin genes are found in several clusters throughout the genome, with this gene mapping to a cluster at 20q11.1. Two transcript variants, one protein-coding and the other not, have been found for this gene. [provided by RefSeq, Nov 2014]
  Transcript Variant: This variant (1) represents the protein-coding transcript.