PIGP (NM_153681) Human Untagged Clone

CAT#: SC306639

PIGP (untagged)-Human phosphatidylinositol glycan anchor biosynthesis, class P (PIGP), transcript variant 1

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: PIGP
• Synonyms: DCRC; DCRC-S; DSCR5; DSRC; EIEE55; PIG-P
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_153681, the custom clone sequence may differ by one or more nucleotides
  ATGGTGCCACGGAGCACATCGCTGACGCTGATTGTGTTCCTTTTCCACAGATTGTCTAAA
  GCCCCAGGAAAAATGGTGGAAAATTCACCGTCGCCATTGCCAGAAAGAGCGATTTATGGC
  TTTGTTCTTTTCTTAAGCTCCCAATTTGGCTTCATACTTTACCTCGTGTGGGCCTTTATT
  CCTGAATCTTGGCTAAACTCTTTAGGTTTAACCTATTGGCCTCAAAAATATTGGGCAGTT
  GCATTACCTGTCTACCTCCTTATTGCTATAGTAATTGGCTACGTGCTCTTGTTTGGGATT
  AACATGATGAGTACCTCTCCACTCGACTCCATCCATACAATCACAGATAACTATGCAAAA
  AATCAACAGCAGAAGAAATACCAAGAGGAGGCCATTCCAGCCTTAAGAGATATTTCTATT
  AGTGAAGTAAACCAAATGTTCTTTCTTGCAGCCAAAGAACTTTACACCAAAAACTGA
  
• Restriction Sites: Please inquire
• ACCN: NM_153681
• ORF Size: 477 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_153681.2, NP_710148.1
• RefSeq Size: 911
• RefSeq ORF: 477
• Locus ID: 51227
• Protein Families: Transmembrane
• Protein Pathways: Glycosylphosphatidylinositol(GPI)-anchor biosynthesis, Metabolic pathways
• Gene Summary: This gene encodes an enzyme involved in the first step of glycosylphosphatidylinositol (GPI)-anchor biosynthesis. The GPI-anchor is a glycolipid found on many blood cells that serves to anchor proteins to the cell surface. The encoded protein is a component of the GPI-N-acetylglucosaminyltransferase complex that catalyzes the transfer of N-acetylglucosamine (GlcNAc) from UDP-GlcNAc to phosphatidylinositol (PI). This gene is located in the Down Syndrome critical region on chromosome 21 and is a candidate for the pathogenesis of Down syndrome. This gene has multiple pseudogenes and is a member of the phosphatidylinositol glycan anchor biosynthesis gene family. Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, Feb 2016]
  Transcript Variant: This variant (1) encodes the longest isoform (1).