IL28B (IFNL3) (NM_172139) Human Untagged Clone

CAT#: SC306726

IFNL3 (untagged)-Human interleukin 28B (interferon, lambda 3) (IL28B)

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: IFNL3
• Synonyms: IFN-lambda-3; IFN-lambda-4; IL-28B; IL-28C; IL28B; IL28C
• Vector: pCMV6-XL4
• E. coli Selection: Ampicillin (100 ug/mL)
• Mammalian Cell Selection: None
• Sequence Data:
  Fully Sequenced ORF

  >OriGene sequence for NM_172139 edited
  CTGCATTCCCTCAGCTCCCTTTCTCTCTGTGACACAGACATGACCGGGGACTGCATGCCA
  G:TGCTGGTGCTGATGGCCGCAGTGCTGACCGTGACTGGAGCAGTTCCTGTCGCCAGGCT
  CCGCGGGGCTCTCCCGGATGCAAGGGGCTGCCACATAGCCCAGTTCAAGTCCCTGTCTCC
  ACAGGAG:CTGCAGGCCTTTAAGAGGGCCAAAGATGCCTTAGAAGAGTCGCTTCTGCTGA
  AGGACTGCAAGTGCCGCTCCCGCCTCTTCCCCAGGACCTGGGACCTGAGGCAGCTGCAGG
  TGAGGGAGCGCCCCGTGGCTTTGGAGGCTGAGCTGGCCCTGACGCTGAAGGTTCTGGAGG
  CCACCGCTGACACTGACCCAGCCCTGGGGGATGTCTTGGACCAGCCCCTTCACACCCTGC
  ACCATATCCTCTCCCAGCTCCGGGCCTGTATCCAGCCTCAGCCCACGGCAGGGCCCAGGA
  CCCGGGGCCGCCTCCACCATTGGCTGCACCGGCTCCAGGAGGCCCCAAAAAAGGAGTCCC
  CTGGCTGCCTCGAGGCCTCTGTCACCTTCAACCTCTTCCGCCTCCTCACGCGAGACCTGA
  ATTGTGTTGCCAGCGGGGACCTGTGTGTCTGACCCTTCCGCCAGTCATGCAACCTGAG
  
• Restriction Sites: Please inquire
• ACCN: NM_172139
• ORF Size: 591 bp
• Insert Size: 600
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: The ORF of this clone has been fully sequenced and found to be a perfect match to NM_172139.2.

Reference Data

• RefSeq: NM_172139.2, NP_742151.2
• RefSeq Size: 595
• RefSeq ORF: 591
• Locus ID: 282617
• Protein Families: Druggable Genome, Secreted Protein, Transmembrane
• Protein Pathways: Cytokine-cytokine receptor interaction, Jak-STAT signaling pathway
• Gene Summary: This gene encodes a cytokine distantly related to type I interferons and the IL-10 family. This gene, interleukin 28A (IL28A), and interleukin 29 (IL29) are three closely related cytokine genes that form a cytokine gene cluster on a chromosomal region mapped to 19q13. Expression of the cytokines encoded by the three genes can be induced by viral infection. All three cytokines have been shown to interact with a heterodimeric class II cytokine receptor that consists of interleukin 10 receptor, beta (IL10RB) and interleukin 28 receptor, alpha (IL28RA). [provided by RefSeq, Jul 2008]
  Transcript Variant: This variant (2) uses an alternate 5' terminal exon resulting in a novel 5' UTR, and the use of a downstream start codon compared to variant 1. The encoded isoform (2) has a shorter N-terminus, and contains a signal peptide, compared to isoform 1.