IL28B (IFNL3) (NM_172139) Human Untagged Clone
CAT#: SC306726
IFNL3 (untagged)-Human interleukin 28B (interferon, lambda 3) (IL28B)
"NM_172139" in other vectors (4)
Product Images
![](https://cdn.origene.com/img/defaults-img-expression-plasmids.jpg)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | IFNL3 |
Synonyms | IFN-lambda-3; IFN-lambda-4; IL-28B; IL-28C; IL28B; IL28C |
Vector | pCMV6-XL4 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>OriGene sequence for NM_172139 edited
CTGCATTCCCTCAGCTCCCTTTCTCTCTGTGACACAGACATGACCGGGGACTGCATGCCA G:TGCTGGTGCTGATGGCCGCAGTGCTGACCGTGACTGGAGCAGTTCCTGTCGCCAGGCT CCGCGGGGCTCTCCCGGATGCAAGGGGCTGCCACATAGCCCAGTTCAAGTCCCTGTCTCC ACAGGAG:CTGCAGGCCTTTAAGAGGGCCAAAGATGCCTTAGAAGAGTCGCTTCTGCTGA AGGACTGCAAGTGCCGCTCCCGCCTCTTCCCCAGGACCTGGGACCTGAGGCAGCTGCAGG TGAGGGAGCGCCCCGTGGCTTTGGAGGCTGAGCTGGCCCTGACGCTGAAGGTTCTGGAGG CCACCGCTGACACTGACCCAGCCCTGGGGGATGTCTTGGACCAGCCCCTTCACACCCTGC ACCATATCCTCTCCCAGCTCCGGGCCTGTATCCAGCCTCAGCCCACGGCAGGGCCCAGGA CCCGGGGCCGCCTCCACCATTGGCTGCACCGGCTCCAGGAGGCCCCAAAAAAGGAGTCCC CTGGCTGCCTCGAGGCCTCTGTCACCTTCAACCTCTTCCGCCTCCTCACGCGAGACCTGA ATTGTGTTGCCAGCGGGGACCTGTGTGTCTGACCCTTCCGCCAGTCATGCAACCTGAG |
Restriction Sites | Please inquire |
ACCN | NM_172139 |
ORF Size | 591 bp |
Insert Size | 600 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | The ORF of this clone has been fully sequenced and found to be a perfect match to NM_172139.2. |
Reference Data | |
RefSeq | NM_172139.2, NP_742151.2 |
RefSeq Size | 595 |
RefSeq ORF | 591 |
Locus ID | 282617 |
Protein Families | Druggable Genome, Secreted Protein, Transmembrane |
Protein Pathways | Cytokine-cytokine receptor interaction, Jak-STAT signaling pathway |
Gene Summary | This gene encodes a cytokine distantly related to type I interferons and the IL-10 family. This gene, interleukin 28A (IL28A), and interleukin 29 (IL29) are three closely related cytokine genes that form a cytokine gene cluster on a chromosomal region mapped to 19q13. Expression of the cytokines encoded by the three genes can be induced by viral infection. All three cytokines have been shown to interact with a heterodimeric class II cytokine receptor that consists of interleukin 10 receptor, beta (IL10RB) and interleukin 28 receptor, alpha (IL28RA). [provided by RefSeq, Jul 2008] Transcript Variant: This variant (2) uses an alternate 5' terminal exon resulting in a novel 5' UTR, and the use of a downstream start codon compared to variant 1. The encoded isoform (2) has a shorter N-terminus, and contains a signal peptide, compared to isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC218965 | IFNL3 (Myc-DDK-tagged)-Human interleukin 28B (interferon, lambda 3) (IL28B) |
USD 420.00 |
|
RG218965 | IFNL3 (GFP-tagged) - Human interleukin 28B (interferon, lambda 3) (IL28B) |
USD 460.00 |
|
RC218965L3 | Lenti ORF clone of Human interleukin 28B (interferon, lambda 3) (IL28B), Myc-DDK-tagged |
USD 620.00 |
|
RC218965L4 | Lenti ORF clone of Human interleukin 28B (interferon, lambda 3) (IL28B), mGFP tagged |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review