FBXO16 (NM_172366) Human Untagged Clone

CAT#: SC306761

FBXO16 (untagged)-Human F-box protein 16 (FBXO16)

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: FBXO16
• Synonyms: FBX16
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_172366, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGATGGCATTTGCACCTCCAAAAAACACAGATGGTCCCAAAATGCAGACAAAGATGAGCACCTGGACAC
  CCCTAAACCATCAGCTATTGAATGACCGGGTATTTGAAGAAAGAAGAGCCCTGCTTGGCAAATGGTTTGA
  CAAATGGACAGACTCTCAAAGAAGAAGAATCCTCACAGGCCTGTTGGAGCGCTGCTCGCTGTCCCAGCAA
  AAGTTCTGCTGTCGAAAGCTTCAAGAGAAAATTCCAGCAGAAGCCCTGGACTTTACAACCAAGCTTCCAA
  GGGTGTTATCTTTATACATCTTTTCTTTCCTGGACCCTCGGAGCCTTTGTCGTTGTGCACAGGTGTGCTG
  GCATTGGAAGAACCTTGCTGAGCTGGACCAGCTCTGGATGCTGAAATGTTTACGGTTTAACTGGTACATC
  AATTTCTCTCCAACTCCCTTTGAGCAGGGGATCTGGAAGAAGCACTATATTCAAATGGTGAAAGAACTTC
  ATATTACCAAGCCTAAGACACCCCCAAAGGATGGATTTGTAATCGCTGACGTTCAACTAGTTACAAGCAA
  TTCTCCAGAGGAAAAACAGTCCCCTTTATCAGCTTTTCGGTCCTCTTCCTCTTTAAGAAAGAAGAATAAC
  TCAGGGGAGAAAGCACTTCCACCCTGGCGATCTTCTGATAAGCACCCAACAGATATCATTCGTTTTAATT
  ACCTAGACAACCGTGACCCCATGGAGACTGTCCAGCAAGGAAGAAGAAAAAGAAACCAAATGACCCCAGA
  CTTCAGCCGACAGTCACATGATAAGAAAAATAAATTGCAGGACAGAACTAGGCTAAGAAAAGCACAATCA
  ATGATGTCGAGGAGAAATCCCTTCCCACTATGTCCCTAA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_172366
• ORF Size: 879 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_172366.3, NP_758954.1
• RefSeq Size: 1362
• RefSeq ORF: 879
• Locus ID: 157574
• Protein Families: Druggable Genome
• Gene Summary: This gene encodes a member of the F-box protein family, members of which are characterized by an approximately 40 amino acid motif, the F-box. The F-box proteins constitute one of the four subunits of ubiquitin protein ligase complex called SCFs (SKP1-cullin-F-box), which function in phosphorylation-dependent ubiquitination. The F-box proteins are divided into three classes: Fbws containing WD-40 domains, Fbls containing leucine-rich repeats, and Fbxs containing either different protein-protein interaction modules or no recognizable motifs. The protein encoded by this gene belongs to the Fbx class. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Apr 2012]
  Transcript Variant: This variant (1) represents the longer transcript and encodes the longer protein (isoform 1). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.