DAOA (NM_172370) Human Untagged Clone

CAT#: SC306764

DAOA (untagged)-Human D-amino acid oxidase activator (DAOA), transcript variant 1

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: DAOA
• Synonyms: LG72; SG72
• Vector: pCMV6-XL5
• E. coli Selection: Ampicillin (100 ug/mL)
• Mammalian Cell Selection: None
• Sequence Data:
  Fully Sequenced ORF

  >OriGene sequence for NM_172370 edited
  ATGCTGGAAAAGCTGATGGGTGCTGATTCTCTCCAGCTTTTCAGATCCAGATATACATTG
  GGTAAAATCTACTTCATAGGTTTTCAAAAGAGCATTCTTCTGAGCAAATCTGAAAACTCT
  CTAAACTCTATTGCAAAGGAGACAGAAGAAGGAAGAGAGACGGTAACAAGGAAAGAAGGA
  TGGAAGAGAAGGCATGAGGACGGCTATTTGGAAATGGCACAGAGGCATTTACAGAGATCA
  TTATGTCCTTGGGTCTCTTACCTTCCTCAGCCCTATGCAGAGCTTGAAGAAGTAAGCAGC
  CATGTTGGAAAAGTCTTCATGGCAAGAAACTATGAGTTCCTTGCCTATGAGGCCTCTAAG
  GACCGCAGGCAGCCTCTAGAACGAATGTGGACCTGCAACTACAACCAGCAAAAAGACCAG
  TCATGCAACCACAAGGAAATAACTTCTACCAAAGCTGAATGACTCGA
  
• Restriction Sites: Please inquire
• ACCN: NM_172370
• ORF Size: 462 bp
• Insert Size: 500
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: The open reading frame of this TrueClone was fully sequenced and found to be a perfect match to the protein associated to this reference.

Reference Data

• RefSeq: NM_172370.2, NP_758958.2
• RefSeq Size: 742
• RefSeq ORF: 462
• Locus ID: 267012
• Protein Families: Druggable Genome
• Gene Summary: This gene encodes a protein that may function as an activator of D-amino acid oxidase, which degrades the gliotransmitter D-serine, a potent activator of N-methyl-D-aspartate (NMDA) type glutamate receptors. Studies also suggest that one encoded isoform may play a role in mitochondrial function and dendritic arborization. Polymorphisms in this gene have been implicated in susceptibility to schizophrenia and bipolar affective disorder. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Mar 2011]
  Transcript Variant: This variant (1) encodes the longest isoform (1). CCDS Note: This CCDS ID represents the protein described in PMIDs: 12364586 and 14966479. This transcript is supported by AY138546.1. It should be noted this transcript is predicted to undergo nonsense-mediated mRNA decay (NMD). However, the protein is represented because it was detected endogenously in PMID: 18544534. It is likely that the majority of transcripts representing this variant will undergo NMD, while some low level of NMD escape may allow for the expression of this protein. It is likely that the majority of transcripts representing this variant will undergo NMD, while some low level of NMD escape may allow for the expression of this protein.