Calpastatin (CAST) (NM_173061) Human Untagged Clone
CAT#: SC306779
CAST (untagged)-Human calpastatin (CAST), transcript variant 3
"NM_173061" in other vectors (4)
Product Images
![](https://cdn.origene.com/img/defaults-img-expression-plasmids.jpg)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | CAST |
Synonyms | BS-17; calpain inhibitor; calpastatin; heart-type calpastatin; MGC9402; OTTHUMP00000158519; OTTHUMP00000158520; sperm BS-17 component |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_173061, the custom clone sequence may differ by one or more nucleotides
ATGGGCCAGTTTCTATCTTCGACTTTCTTGGAGGGCTCACCGGCCACAGTGTGGCACGATAAGCTTTGTG ACGGTGAACGCAGAGGAGCAAGAGAAGCAGTTCGTATCTTCCAGGACCAAGCAAAAGCTAAAGAAGAAAA ACTAGAGAAGTGTGGTGAGGATGATGAAACAATCCCATCTGAGTACAGATTAAAACCAGCCACGGATAAA GATGGAAAACCACTATTGCCAGAGCCTGAAGAAAAACCCAAGCCTCGGAGTGAATCAGAACTCATTGATG AACTTTCAGAAGATTTTGACCGGTCTGAATGTAAAGAGAAACCATCTAAGCCAACTGAAAAGACAGAAGA ATCTAAGGCCGCTGCTCCAGCTCCTGTGTCGGAGGCTGTGTGTCGGACCTCCATGTGTAGTATACAGTCA GCACCCCCTGAGCCGGCTACCTTGAAGGGCACAGTGCCAGATGATGCTGTAGAAGCCTTGGCTGATAGCC TGGGGAAAAAGGAAGCAGATCCAGAAGATGGAAAACCTGTGATGGATAAAGTCAAGGAGAAGGCCAAAGA AGAAGACCGTGAAAAGCTTGGTGAAAAAGAAGAAACAATTCCTCCTGATTATAGATTAGAAGAGGTCAAG GATAAAGATGGAAAGCCACTCCTGCCAAAAGAGTCTAAGGAACAGCTTCCACCCATGAGTGAAGACTTCC TTCTGGATGCTTTGTCTGAGGACTTCTCTGGTCCACAAAATGCTTCATCTCTTAAATTTGAAGATGCTAA ACTTGCTGCTGCCATCTCTGAAGTGGTTTCCCAAACCCCAGCTTCAACGACCCAAGCTGGAGCCCCACCC CGTGATACCTCGAGTGACAAAGACCTCGATGATGCCTTGGATAAACTCTCTGACAGTCTAGGACAAAGGC AGCCTGACCCAGATGAGAACAAACCAATGGAAGATAAAGTAAAGGAAAAAGCTAAAGCTGAACATAGAGA CAAGCTTGGAGAAAGAGATGACACTATCCCACCTGAATACAGACATCTCCTGGATGATAATGGACAGGAC AAACCAGTGAAGCCACCTACAAAGAAATCAGAGGATTCAAAGAAACCTGCAGATGACCAAGACCCCATTG ATGCTCTCTCAGGAGATCTGGACAGCTGTCCCTCCACTACAGAAACCTCACAGAACACAGCAAAGGATAA GTGCAAGAAGGCTGCTTCCAGCTCCAAAGCACCTAAGAATGGAGGTAAAGCGAAGGATTCAGCAAAGACA ACAGAGGAAACTTCCAAGCCAAAAGATGACTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_173061 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones. |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_173061.2, NP_775084.1 |
RefSeq Size | 3447 bp |
RefSeq ORF | 1293 bp |
Locus ID | 831 |
Cytogenetics | 5q15 |
Gene Summary | 'The protein encoded by this gene is an endogenous calpain (calcium-dependent cysteine protease) inhibitor. It consists of an N-terminal domain L and four repetitive calpain-inhibition domains (domains 1-4), and it is involved in the proteolysis of amyloid precursor protein. The calpain/calpastatin system is involved in numerous membrane fusion events, such as neural vesicle exocytosis and platelet and red-cell aggregation. The encoded protein is also thought to affect the expression levels of genes encoding structural or regulatory proteins. Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, Jun 2010]' Transcript Variant: This variant (3) differs in the 5' UTR and coding region compared to variant 1. The resulting isoform (c, also known as tCAST) has a shorter and distinct N-terminus compared to isoform a. |
Documents
Product Manuals |
FAQs |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC222278 | CAST (Myc-DDK-tagged)-Human calpastatin (CAST), transcript variant 3 |
USD 450.00 |
|
RG222278 | CAST (GFP-tagged) - Human calpastatin (CAST), transcript variant 3 |
USD 500.00 |
|
RC222278L3 | Lenti ORF clone of Human calpastatin (CAST), transcript variant 3, Myc-DDK-tagged |
USD 650.00 |
|
RC222278L4 | Lenti ORF clone of Human calpastatin (CAST), transcript variant 3, mGFP tagged |
USD 804.00 |
{0} Product Review(s)
Be the first one to submit a review