IL1F10 (NM_173161) Human Untagged Clone
CAT#: SC306791
IL1F10 (untagged)-Human interleukin 1 family, member 10 (theta) (IL1F10), transcript variant 2
"NM_173161" in other vectors (4)
Product Images
![](https://cdn.origene.com/img/defaults-img-expression-plasmids.jpg)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | IL1F10 |
Synonyms | FIL1-theta; FKSG75; IL-1HY2; IL-38; IL1-theta; IL1HY2 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_173161, the custom clone sequence may differ by one or more nucleotides
ATGTGTTCCCTCCCCATGGCAAGATACTACATAATTAAATATGCAGACCAGAAGGCTCTATACACAAGAG ATGGCCAGCTGCTGGTGGGAGATCCTGTTGCAGACAACTGCTGTGCAGAGAAGATCTGCATACTTCCTAA CAGAGGCTTGGCCCGCACCAAGGTCCCCATTTTCCTGGGGATCCAGGGAGGGAGCCGCTGCCTGGCATGT GTGGAGACAGAAGAGGGGCCTTCCCTACAGCTGGAGGATGTGAACATTGAGGAACTGTACAAAGGTGGTG AAGAGGCCACACGCTTCACCTTCTTCCAGAGCAGCTCAGGCTCCGCCTTCAGGCTTGAGGCTGCTGCCTG GCCTGGCTGGTTCCTGTGTGGCCCGGCAGAGCCCCAGCAGCCAGTACAGCTCACCAAGGAGAGTGAGCCC TCAGCCCGTACCAAGTTTTACTTTGAACAGAGCTGGTAG |
Restriction Sites | SgfI-MluI |
ACCN | NM_173161 |
ORF Size | 459 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Reference Data | |
RefSeq | NM_173161.2, NP_775184.1 |
RefSeq Size | 1027 |
RefSeq ORF | 459 |
Locus ID | 84639 |
Protein Families | Druggable Genome, Secreted Protein |
Gene Summary | The protein encoded by this gene is a member of the interleukin 1 cytokine family. This gene and eight other interleukin 1 family genes form a cytokine gene cluster on chromosome 2. This cytokine is thought to participate in a network of interleukin 1 family members to regulate adapted and innate immune responses. Two alternatively spliced transcript variants encoding the same protein have been reported. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (2) differs in the 5' UTR compared to variant 1. Both variants encode the same protein. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC222361 | IL1F10 (Myc-DDK-tagged)-Human interleukin 1 family, member 10 (theta) (IL1F10), transcript variant 2 |
USD 420.00 |
|
RG222361 | IL1F10 (GFP-tagged) - Human interleukin 1 family, member 10 (theta) (IL1F10), transcript variant 2 |
USD 460.00 |
|
RC222361L3 | Lenti ORF clone of Human interleukin 1 family, member 10 (theta) (IL1F10), transcript variant 2, Myc-DDK-tagged |
USD 620.00 |
|
RC222361L4 | Lenti ORF clone of Human interleukin 1 family, member 10 (theta) (IL1F10), transcript variant 2, mGFP tagged |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review