KChIP2 (KCNIP2) (NM_173193) Human Untagged Clone

CAT#: SC306796

KCNIP2 (untagged)-Human Kv channel interacting protein 2 (KCNIP2), transcript variant 4

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: KCNIP2
• Synonyms: KCHIP2
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_173193, the custom clone sequence may differ by one or more nucleotides
  ATGCGGGGCCAGGGCCGCAAGGAGAGTTTGTCCGATTCCCGAGACCTGGACGGCTCCTAC
  GACCAGCTCACGGACAGCGTGGACGATGAATTTGAATTGTCCACCGTGTGTCACCGGCCT
  GAGGGTCTGGAGCAGCTGCAGGAGCAAACCAAATTCACGCGCAAGGAGTTGCAGGTCCTG
  TACCGGGGCTTCAAGAACCCTGGTGCCCTCTCCTTCCAGGAATGTCCCAGCGGAATTGTC
  AATGAGGAGAACTTCAAGCAGATTTACTCCCAGTTCTTTCCTCAAGGAGACTCCAGCACC
  TATGCCACTTTTCTCTTCAATGCCTTTGACACCAACCATGATGGCTCGGTCAGTTTTGAG
  GACTTTGTGGCTGGTTTGTCCGTGATTCTTCGGGGAACTGTAGATGACAGGCTTAATTGG
  GCCTTCAACCTGTATGACCTTAACAAGGACGGCTGCATCACCAAGGAGGAAATGCTTGAC
  ATCATGAAGTCCATCTATGACATGATGGGCAAGTACACGTACCCTGCACTCCGGGAGGAG
  GCCCCAAGGGAACACGTGGAGAGCTTCTTCCAGAAGATGGACAGAAACAAGGATGGTGTG
  GTGACCATTGAGGAATTCATTGAGTCTTGTCAAAAGGATGAGAACATCATGAGGTCCATG
  CAGCTCTTTGACAATGTCATCTAG
  
• Restriction Sites: Please inquire
• ACCN: NM_173193
• ORF Size: 684 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_173193.2, NP_775285.1
• RefSeq Size: 2434
• RefSeq ORF: 684
• Locus ID: 30819
• Protein Families: Druggable Genome, Ion Channels: Other
• Gene Summary: This gene encodes a member of the family of voltage-gated potassium (Kv) channel-interacting proteins (KCNIPs), which belongs to the recoverin branch of the EF-hand superfamily. Members of the KCNIP family are small calcium binding proteins. They all have EF-hand-like domains, and differ from each other in the N-terminus. They are integral subunit components of native Kv4 channel complexes. They may regulate A-type currents, and hence neuronal excitability, in response to changes in intracellular calcium. Multiple alternatively spliced transcript variants encoding distinct isoforms have been identified from this gene. [provided by RefSeq, Jul 2008]
  Transcript Variant: This variant (4), also known as KChIP2S, lacks two consecutive in-frame segment and has an additional in-frame segment in the coding region, as compared to variant 1. Isoform 4 is shorter, but has the same N- and C-termini, as compared to isoform 1.