ST3GAL3 (NM_174963) Human Untagged Clone

CAT#: SC306970

ST3GAL3 (untagged)-Human ST3 beta-galactoside alpha-2,3-sialyltransferase 3 (ST3GAL3), transcript variant 1

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: ST3GAL3
• Synonyms: EIEE15; MRT12; SIAT6; ST3GALII; ST3Gal III; ST3GalIII; ST3N
• Vector: pCMV6-XL5
• E. coli Selection: Ampicillin (100 ug/mL)
• Mammalian Cell Selection: None
• Sequence Data:
  Fully Sequenced ORF

  >OriGene sequence for NM_174963 edited
  GTAAATCATGTGAAGATGGGACTCTTGGTATTTGTGCGCAATCTGCTGCTAGCCCTCTGC
  CTCTTTCTGGTACTGGGATTTTTGTATTATTCTGCGTGGAAGCTACACTTACTCCAGTGG
  GAGGAGGACTCCAGTAAGTATAGTCACTCTAGCTCACCCCAGGAGAAGCCTGTTGCAGAT
  TCAGTGGTTCTTTCCTTTGACTCCGCTGGACAAACACTAGGCTCAGAGTATGATCGGTTG
  GGCTTCCTCCTGAATCTGGACTCTAAACTCTCACCGAGGACTCTCTGCACGGTGGTTTTT
  GGCCTTGACTGCATATTGGAATCACCTGGAGAGCCTAAAAAATTACTGATGCCTGCATCC
  CACCCTCTAGAGATTTTGAAGTCACTGAGCGAGGACACAGCCTTTGCATTAGGATTTTTA
  AAGCTGCCCAGGCCTGCTGAATTAGCCACCAAGTACGCAAACTTTTCAGAGGGAGCTTGC
  AAGCCTGGCTATGCTTCAGCCTTGATGACGGCCATCTTCCCCCGGTTCTCCAAGCCAGCA
  CCCATGTTCCTGGATGACTCCTTTCGCAAGTGGGCTAGAATCCGGGAGTTCGTGCCGCCT
  TTTGGGATCAAAGGTCAAGACAATCTGATCAAAGCCATCTTGTCAGTCACCAAAGAGTAC
  CGCCTGACCCCTGCCTTGGACAGCCTCCGCTGCCGCCGCTGCATCATCGTGGGCAATGGA
  GGCGTTCTTGCCAACAAGTCTCTGGGGTCACGAATTGACGACTATGACATTGTGGTGAGA
  CTGAATTCAGCACCAGTGAAAGGCTTTGAGAAGGACGTGGGCAGCAAAACGACACTGCGC
  ATCACCTACCCCGAGGGCGCCATGCAGCGGCCTGAGCAGTACGAGCGCGATTCTCTCTTT
  GTCCTCGCCGGCTTCAAGTGGCAGGACTTTAAGTGGTTGAAATACATCGTCTACAAGGAG
  AGAGTGAGTGCATCGGATGGCTTCTGGAAATCTGTGGCCACTCGAGTGCCCAAGGAGCCC
  CCTGAGATTCGAATCCTCAACCCATATTTCATCCAGGAGGCCGCCTTCACCCTCATTGGC
  CTGCCCTTCAACAATGGCCTCATGGGCCGGGGGAACATCCCTACCCTTGGCAGTGTGGCA
  GTGACCATGGCACTACACGGCTGTGACGAGGTGGCAGTCGCAGGATTTGGCTATGACATG
  AGCACACCCAACGCACCCCTGCACTACTATGAGACCGTTCGCATGGCAGCCATCAAAGAG
  TCCTGGACGCACAATATCCAGCGAGAGAAAGAGTTTCTGCGGAAGCTGGTGAAAGCTCGC
  GTCATCACTGATCTAAGCAGTGGCATCTGA
  
• Restriction Sites: Please inquire
• ACCN: NM_174963
• Insert Size: 1400 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_174963.1, NP_777623.1
• RefSeq Size: 2478 bp
• RefSeq ORF: 1335 bp
• Locus ID: 6487
• Cytogenetics: 1p34.1
• Protein Families: Secreted Protein, Transmembrane
• Protein Pathways: Glycosphingolipid biosynthesis - lacto and neolacto series, Keratan sulfate biosynthesis, Metabolic pathways
• Gene Summary: 'The protein encoded by this gene is a type II membrane protein that catalyzes the transfer of sialic acid from CMP-sialic acid to galactose-containing substrates. The encoded protein is normally found in the Golgi apparatus but can be proteolytically processed to a soluble form. This protein is a member of glycosyltransferase family 29. Mutations in this gene have been associated with a form of autosomal recessive nonsymdromic cognitive disability as well as infantile epileptic encephalopathy. Multiple transcript variants encoding several different isoforms have been found for this gene. [provided by RefSeq, Jul 2017]'
  Transcript Variant: This variant (1) represents the longest transcript and encodes the longest isoform (a, also called A8). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.