LYG2 (NM_175735) Human Untagged Clone

CAT#: SC307022

LYG2 (untagged)-Human lysozyme G-like 2 (LYG2)


  "NM_175735" in other vectors (4)

Reconstitution Protocol

USD 420.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "LYG2"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol LYG2
Synonyms LYGH; LYSG2
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_175735, the custom clone sequence may differ by one or more nucleotides


ATGTTATCCTCCGTGGTGTTTTGGGGACTAATTGCCCTCATTGGCACTTCCAGGGGCTCATACCCCTTCA
GTCACTCAATGAAGCCTCACCTACATCCACGCCTGTACCACGGCTGCTATGGGGACATCATGACCATGAA
GACCTCTGGGGCCACTTGTGATGCAAACAGTGTGATGAACTGCGGGATCCGTGGTTCTGAAATGTTTGCT
GAGATGGATTTGAGGGCCATAAAACCTTACCAGACTCTGATCAAAGAAGTCGGGCAGAGACATTGCGTGG
ACCCTGCTGTCATCGCAGCCATCATCTCCAGGGAAAGCCATGGCGGATCTGTCCTGCAAGACGGCTGGGA
CCACAGGGGACTTAAATTTGGCTTGATGCAGCTTGATAAACAAACGTACCACCCTGTCGGTGCCTGGGAT
AGCAAAGAGCACCTTTCACAGGCTACTGGGATTCTAACAGAGAGAATTAAGGCAATCCAGAAAAAATTCC
CCACGTGGAGTGTTGCTCAGCACCTCAAAGGTGGTCTCTCAGCTTTTAAGTCAGGAATTGAAGCGATTGC
CACCCCATCGGACATAGACAATGACTTCGTCAATGATATCATTGCTCGAGCTAAGTTCTATAAAAGACAA
AGCTTCTAG


Restriction Sites SgfI-MluI     
ACCN NM_175735
ORF Size 639 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Reference Data
RefSeq NM_175735.3, NP_783862.2
RefSeq Size 880
RefSeq ORF 639
Locus ID 254773
Protein Families Secreted Protein
Gene Summary The protein encoded by this gene contains a SLT domain, a protein domain present in bacterial lytic transglycosylase (SLT) and in eukaryotic lysozymes (GEWL). SLT domain catalyzes the cleavage of the beta-1,4-glycosidic bond between N-acetylmuramic acid (MurNAc) and N-acetyglucosamine (GlcNAc). [provided by RefSeq, Jul 2008]

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.