LYG2 (NM_175735) Human Untagged Clone
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | LYG2 |
Synonyms | LYGH; LYSG2 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_175735, the custom clone sequence may differ by one or more nucleotides
ATGTTATCCTCCGTGGTGTTTTGGGGACTAATTGCCCTCATTGGCACTTCCAGGGGCTCATACCCCTTCA GTCACTCAATGAAGCCTCACCTACATCCACGCCTGTACCACGGCTGCTATGGGGACATCATGACCATGAA GACCTCTGGGGCCACTTGTGATGCAAACAGTGTGATGAACTGCGGGATCCGTGGTTCTGAAATGTTTGCT GAGATGGATTTGAGGGCCATAAAACCTTACCAGACTCTGATCAAAGAAGTCGGGCAGAGACATTGCGTGG ACCCTGCTGTCATCGCAGCCATCATCTCCAGGGAAAGCCATGGCGGATCTGTCCTGCAAGACGGCTGGGA CCACAGGGGACTTAAATTTGGCTTGATGCAGCTTGATAAACAAACGTACCACCCTGTCGGTGCCTGGGAT AGCAAAGAGCACCTTTCACAGGCTACTGGGATTCTAACAGAGAGAATTAAGGCAATCCAGAAAAAATTCC CCACGTGGAGTGTTGCTCAGCACCTCAAAGGTGGTCTCTCAGCTTTTAAGTCAGGAATTGAAGCGATTGC CACCCCATCGGACATAGACAATGACTTCGTCAATGATATCATTGCTCGAGCTAAGTTCTATAAAAGACAA AGCTTCTAG |
Restriction Sites | SgfI-MluI |
ACCN | NM_175735 |
ORF Size | 639 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Reference Data | |
RefSeq | NM_175735.3, NP_783862.2 |
RefSeq Size | 880 |
RefSeq ORF | 639 |
Locus ID | 254773 |
Protein Families | Secreted Protein |
Gene Summary | The protein encoded by this gene contains a SLT domain, a protein domain present in bacterial lytic transglycosylase (SLT) and in eukaryotic lysozymes (GEWL). SLT domain catalyzes the cleavage of the beta-1,4-glycosidic bond between N-acetylmuramic acid (MurNAc) and N-acetyglucosamine (GlcNAc). [provided by RefSeq, Jul 2008] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC223549 | LYG2 (Myc-DDK-tagged)-Human lysozyme G-like 2 (LYG2) |
USD 420.00 |
|
RG223549 | LYG2 (GFP-tagged) - Human lysozyme G-like 2 (LYG2) |
USD 460.00 |
|
RC223549L3 | Lenti ORF clone of Human lysozyme G-like 2 (LYG2), Myc-DDK-tagged |
USD 620.00 |
|
RC223549L4 | Lenti ORF clone of Human lysozyme G-like 2 (LYG2), mGFP tagged |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review