NHLRC4 (NM_176677) Human Untagged Clone
CAT#: SC307064
NHLRC4 (untagged)-Human NHL repeat containing 4 (NHLRC4)
"NM_176677" in other vectors (4)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | NHLRC4 |
Synonyms | FLJ36208 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_176677, the custom clone sequence may differ by one or more nucleotides
ATGCTGGGTCTGGAGGGCCCCTGCTGGGTGGGCCCAGGGCCTGATGGGGGCCTTGCTGTGAGTGAGGAGT TTGGGGATGTGAGGCTGTTTGGCAGTGCCCGCCAACCCCTGGGCTCCCTGGGGGGCTGGACGGGGCACAC TTTCGGCTGCCCAGCGGGCATCTGCTCCAACTCAGAGGGCAATGTTATTGTGGCAGACGAGCAGAGGCGC CAGGTGACCCTGTTTCCCCGGGCTGGGCCACCCATCTGCCTGGTGTCAGAGGGGCTTGGGCAGCCCTTGG GAGTGGCCTGTGCACCCCAGGGCCAGCTCCTGGTGGCTGATGCCAAGGACAACTCCATCAAGGTGTACCA GGGCCTCAAGGAGCTGGCCTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_176677 |
ORF Size | 372 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Reference Data | |
RefSeq | NM_176677.2, NP_788850.1 |
RefSeq Size | 2102 |
RefSeq ORF | 372 |
Locus ID | 283948 |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC213434 | NHLRC4 (Myc-DDK-tagged)-Human NHL repeat containing 4 (NHLRC4) |
USD 98.00 |
|
RG213434 | NHLRC4 (GFP-tagged) - Human NHL repeat containing 4 (NHLRC4) |
USD 460.00 |
|
RC213434L3 | Lenti ORF clone of Human NHL repeat containing 4 (NHLRC4), Myc-DDK-tagged |
USD 620.00 |
|
RC213434L4 | Lenti ORF clone of Human NHL repeat containing 4 (NHLRC4), mGFP tagged |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review