PPA2 (NM_176867) Human Untagged Clone

CAT#: SC307075

PPA2 (untagged)-Human pyrophosphatase (inorganic) 2 (PPA2), nuclear gene encoding mitochondrial protein, transcript variant 4


  "NM_176867" in other vectors (4)

Reconstitution Protocol

USD 420.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "PPA2"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol PPA2
Synonyms HSPC124; SCFAI; SCFI; SID6-306
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_176867, the custom clone sequence may differ by one or more nucleotides
ATGAGCGCGCTGCTGCGGCTGCTGCGCACGGGTGCCCCAGCCGCTGCGTGCCTGCGGTTG
GGGACCAGTGCAGGGACCGGGTCGCGCCGTGCTATGGCCCTGTACCACACTGAGGAGCGC
GGCCAGCCCTGCTCGCAGAATTACCGCCTCTTCTTTAATATTGATGATGTTAAGAAGTTC
AAACCGGGTTACCTGGAAGCTACTCTTAATTGGTTTAGATTATATAAGGTACCAGATGGA
AAACCAGAAAACCAGTTTGCTTTTAATGGAGAATTCAAAAACAAGGCTTTTGCTCTTGAA
GTTATTAAATCCACTCATCAATGTTGGAAAGCATTGCTTATGAAGAAGTGTAATGGAGGA
GCTATAAATTGCACAAACGTGCAGATATCTGATAGCCCTTTCCGTTGCACTCAAGAGGAA
GCAAGATCATTAGTTGAATCGGTATCATCTTCACCAAATAAAGAAAGTAATGAAGAAGAG
CAAGTGTGGCACTTCCTTGGCAAGTGA
Restriction Sites Please inquire     
ACCN NM_176867
ORF Size 507 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Reference Data
RefSeq NM_176867.3, NP_789843.2
RefSeq Size 1184
RefSeq ORF 507
Locus ID 27068
Protein Pathways Oxidative phosphorylation
Gene Summary The protein encoded by this gene is localized to the mitochondrion, is highly similar to members of the inorganic pyrophosphatase (PPase) family, and contains the signature sequence essential for the catalytic activity of PPase. PPases catalyze the hydrolysis of pyrophosphate to inorganic phosphate, which is important for the phosphate metabolism of cells. Alternate transcriptional splice variants, encoding different isoforms, have been characterized. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (4) lacks an in-frame coding segment, when compared to variant 1. The resulting isoform (4) is shorter and lacks an internal region, as compared to isoform 1.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.