TAS2R40 (NM_176882) Human Untagged Clone

CAT#: SC307078

TAS2R40 (untagged)-Human taste receptor, type 2, member 40 (TAS2R40)


  "NM_176882" in other vectors (4)

Reconstitution Protocol

USD 660.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "TAS2R40"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol TAS2R40
Synonyms GPR60; T2R40; T2R58
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_176882, the custom clone sequence may differ by one or more nucleotides


ATGGCAACGGTGAACACAGATGCCACAGATAAAGACATATCCAAGTTCAAGGTCACCTTCACTTTGGTGG
TCTCCGGAATAGAGTGCATCACTGGCATCCTTGGGAGTGGCTTCATCACGGCCATCTATGGGGCTGAGTG
GGCCAGGGGCAAAACACTCCCCACTGGTGACCGCATTATGTTGATGCTGAGCTTTTCCAGGCTCTTGCTA
CAGATTTGGATGATGCTGGAGAACATTTTCAGTCTGCTATTCCGAATTGTTTATAACCAAAACTCAGTGT
ATATCCTCTTCAAAGTCATCACTGTCTTTCTGAACCATTCCAATCTCTGGTTTGCTGCCTGGCTCAAAGT
CTTCTATTGTCTTAGAATTGCAAACTTCAATCATCCTTTGTTCTTCCTGATGAAGAGGAAAATCATAGTG
CTGATGCCTTGGCTTCTCAGGCTGTCAGTGTTGGTTTCCTTAAGCTTCAGCTTTCCTCTCTCGAGAGATG
TCTTCAATGTGTATGTGAATAGCTCCATTCCTATCCCCTCCTCCAACTCCACGGAGAAGAAGTACTTCTC
TGAGACCAATATGGTCAACCTGGTATTTTTCTATAACATGGGGATCTTCGTTCCTCTGATCATGTTCATC
CTGGCAGCCACCCTGCTGATCCTCTCTCTCAAGAGACACACCCTACACATGGGAAGCAATGCCACAGGGT
CCAGGGACCCCAGCATGAAGGCTCACATAGGGGCCATCAAAGCCACCAGCTACTTTCTCATCCTCTACAT
TTTCAATGCAATTGCTCTATTTCTTTCCACGTCCAACATCTTTGACACTTACAGTTCCTGGAATATTTTG
TGCAAGATCATCATGGCTGCCTACCCTGCCGGCCACTCAGTACAACTGATCTTGGGCAACCCTGGGCTGA
GAAGAGCCTGGAAGCGGTTTCAGCACCAAGTTCCTCTTTACCTAAAAGGGCAGACTCTGTGA


Restriction Sites SgfI-MluI     
ACCN NM_176882
ORF Size 972 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Reference Data
RefSeq NM_176882.1, NP_795363.1
RefSeq Size 972
RefSeq ORF 972
Locus ID 259286
Protein Pathways Taste transduction
Gene Summary This gene encodes a member of the bitter taste receptor family which belong to the G protein-coupled receptor superfamily and are predominantly expressed in taste receptor cells of the tongue and palate epithelia. This intronless taste receptor gene encodes a seven-transmembrane receptor protein, functioning as a bitter taste receptor. This gene is clustered together with eight other taste receptor genes on chromosome 7. A decrease in the expression of this gene is associated with hypogeusia. [provided by RefSeq, Jul 2017]

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.