TAS2R49 (TAS2R20) (NM_176889) Human Untagged Clone

CAT#: SC307083

TAS2R20 (untagged)-Human taste receptor, type 2, member 20 (TAS2R20)


  "NM_176889" in other vectors (4)

Reconstitution Protocol

USD 660.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "TAS2R20"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol TAS2R20
Synonyms T2R20; T2R49; T2R56; TAS2R49
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_176889, the custom clone sequence may differ by one or more nucleotides


ATGATGAGTTTTCTACACATTGTTTTTTCCATTCTAGTAGTGGTTGCATTTATTCTTGGAAATTTTGCCA
ATGGCTTTATAGCACTGATAAATTTCATTGCCTGGGTCAAGAGACAAAAGATCTCCTCAGCTGATCAAAT
TATTGCTGCTCTGGCAGTCTCCAGAGTTGGTTTGCTCTGGGTAATATTATTACATTGGTATTCAACTGTG
TTGAATCCAACTTCATCTAATTTAAAAGTAATAATTTTTATTTCTAATGCCTGGGCAGTAACCAATCATT
TCAGCATCTGGCTTGCTACTAGCCTCAGCATATTTTATTTGCTCAAGATCGTCAATTTCTCCAGACTTAT
TTTTCATCACTTAAAAAGGAAGGCTAAGAGTGTAGTTCTGGTGATAGTGTTGGGGTCTTTGTTCTTTTTG
GTTTGTCACCTTGTGATGAAACACACGTATATAAATGTGTGGACAGAAGAATGTGAAGGAAACGTAACTT
GGAAGATCAAACTGAGGAATGCAATGCACCTTTCCAACTTGACTGTAGCCATGCTAGCAAACTTGATACC
ATTCACTCTGACCCTGATATCTTTTCTGCTGTTAATCTACTCTCTGTGTAAACATCTGAAGAAGATGCAG
CTCCATGGCAAAGGATCTCAAGATCCCAGCACCAAGATCCACATAAAAGCTCTGCAAACTGTGACCTCCT
TCCTCATATTACTTGCCATTTACTTTCTGTGTCTAATCATATCGTTTTGGAATTTTAAGATGCGACCAAA
AGAAATTGTCTTAATGCTTTGCCAAGCTTTTGGAATCATATATCCATCATTCCACTCATTCATTCTGATT
TGGGGGAACAAGACGCTAAAGCAGACCTTTCTTTCAGTTTTGTGGCAGGTGACTTGCTGGGCAAAAGGAC
AGAACCAGTCAACTCCATAG


Restriction Sites SgfI-MluI     
ACCN NM_176889
ORF Size 930 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Reference Data
RefSeq NM_176889.3, NP_795370.2
RefSeq Size 2343
RefSeq ORF 930
Locus ID 259295
Protein Families Transmembrane
Protein Pathways Taste transduction
Gene Summary This gene encodes a member of the taste receptor two family of class C G-protein coupled receptors. Receptors of this family have a short extracellular N-terminus, seven transmembrane helices, three extracellular loops and three intracellular loops, and an intracellular C-terminus. Members of this family are expressed in a subset of taste receptor cells, where they function in bitter taste reception, as well as in non-gustatory cells including those of the brain, reproductive organs, respiratory system, and gastrointestinal system. This gene maps to the taste receptor gene cluster on chromosome 12p13. [provided by RefSeq, Jul 2016]

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.