TAS2R49 (TAS2R20) (NM_176889) Human Untagged Clone
CAT#: SC307083
TAS2R20 (untagged)-Human taste receptor, type 2, member 20 (TAS2R20)
"NM_176889" in other vectors (4)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | TAS2R20 |
Synonyms | T2R20; T2R49; T2R56; TAS2R49 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_176889, the custom clone sequence may differ by one or more nucleotides
ATGATGAGTTTTCTACACATTGTTTTTTCCATTCTAGTAGTGGTTGCATTTATTCTTGGAAATTTTGCCA ATGGCTTTATAGCACTGATAAATTTCATTGCCTGGGTCAAGAGACAAAAGATCTCCTCAGCTGATCAAAT TATTGCTGCTCTGGCAGTCTCCAGAGTTGGTTTGCTCTGGGTAATATTATTACATTGGTATTCAACTGTG TTGAATCCAACTTCATCTAATTTAAAAGTAATAATTTTTATTTCTAATGCCTGGGCAGTAACCAATCATT TCAGCATCTGGCTTGCTACTAGCCTCAGCATATTTTATTTGCTCAAGATCGTCAATTTCTCCAGACTTAT TTTTCATCACTTAAAAAGGAAGGCTAAGAGTGTAGTTCTGGTGATAGTGTTGGGGTCTTTGTTCTTTTTG GTTTGTCACCTTGTGATGAAACACACGTATATAAATGTGTGGACAGAAGAATGTGAAGGAAACGTAACTT GGAAGATCAAACTGAGGAATGCAATGCACCTTTCCAACTTGACTGTAGCCATGCTAGCAAACTTGATACC ATTCACTCTGACCCTGATATCTTTTCTGCTGTTAATCTACTCTCTGTGTAAACATCTGAAGAAGATGCAG CTCCATGGCAAAGGATCTCAAGATCCCAGCACCAAGATCCACATAAAAGCTCTGCAAACTGTGACCTCCT TCCTCATATTACTTGCCATTTACTTTCTGTGTCTAATCATATCGTTTTGGAATTTTAAGATGCGACCAAA AGAAATTGTCTTAATGCTTTGCCAAGCTTTTGGAATCATATATCCATCATTCCACTCATTCATTCTGATT TGGGGGAACAAGACGCTAAAGCAGACCTTTCTTTCAGTTTTGTGGCAGGTGACTTGCTGGGCAAAAGGAC AGAACCAGTCAACTCCATAG |
Restriction Sites | SgfI-MluI |
ACCN | NM_176889 |
ORF Size | 930 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Reference Data | |
RefSeq | NM_176889.3, NP_795370.2 |
RefSeq Size | 2343 |
RefSeq ORF | 930 |
Locus ID | 259295 |
Protein Families | Transmembrane |
Protein Pathways | Taste transduction |
Gene Summary | This gene encodes a member of the taste receptor two family of class C G-protein coupled receptors. Receptors of this family have a short extracellular N-terminus, seven transmembrane helices, three extracellular loops and three intracellular loops, and an intracellular C-terminus. Members of this family are expressed in a subset of taste receptor cells, where they function in bitter taste reception, as well as in non-gustatory cells including those of the brain, reproductive organs, respiratory system, and gastrointestinal system. This gene maps to the taste receptor gene cluster on chromosome 12p13. [provided by RefSeq, Jul 2016] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC213291 | TAS2R20 (Myc-DDK-tagged)-Human taste receptor, type 2, member 20 (TAS2R20) |
USD 420.00 |
|
RG213291 | TAS2R20 (GFP-tagged) - Human taste receptor, type 2, member 20 (TAS2R20) |
USD 460.00 |
|
RC213291L3 | Lenti ORF clone of Human taste receptor, type 2, member 20 (TAS2R20), Myc-DDK-tagged |
USD 620.00 |
|
RC213291L4 | Lenti ORF clone of Human taste receptor, type 2, member 20 (TAS2R20), mGFP tagged |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review