PPP2R4 (PTPA) (NM_178003) Human Untagged Clone

CAT#: SC307119

PPP2R4 (untagged)-Human protein phosphatase 2A activator, regulatory subunit 4 (PPP2R4), transcript variant 5


  "NM_178003" in other vectors (4)

Reconstitution Protocol

USD 660.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "PTPA"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol PTPA
Synonyms PP2A; PPP2R4; PR53
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_178003, the custom clone sequence may differ by one or more nucleotides


ATGGCTGAGGGCGAGCGGCAGCCGCCGCCAGATTCTTCAGAGGAGGCCCCTCCAGCCACTCAGAACTTCA
TCATTCCAAAAAAGGAGATCCACACAGTTCCAGACATGGGCAAATGGAAGCGTTCTCAGGCATACGCTGA
CTACATCGGATTCATCCTTACCCTCAACGAAGGTGTGAAGGGGAAGAAGCTGACCTTCGAGTACAGAGTC
TCCGAGGAAGCAGAAAACTTGGTGGCCACAGTGGTCCCTACCCATCTGGCAGCTGCTGTGCCTGAGGTGG
CTGTTTACCTAAAGGAGTCAGTGGGGAACTCCACGCGCATTGACTACGGCACAGGGCATGAGGCAGCCTT
CGCTGCTTTCCTCTGCTGTCTCTGCAAGATTGGGGTGCTCCGGGTGGATGACCAAATAGCTATTGTCTTC
AAGGTGTTCAATCGGTACCTTGAGGTTATGCGGAAACTCCAGAAAACATACAGGATGGAGCCAGCCGGCA
GCCAGGGAGTGTGGGGTCTGGATGACTTCCAGTTTCTGCCCTTCATCTGGGGCAGTTCGCAGCTGATAGA
CCACCCATACCTGGAGCCCAGACACTTTGTGGATGAGAAGGCCGTGAATGAGAACCACAAGGACTACATG
TTCCTGGAGTGTATCCTGTTTATTACCGAGATGAAGACTGGCCCATTTGCAGAGCACTCCAACCAGCTGT
GGAACATCAGCGCCGTCCCTTCCTGGTCCAAAGTGAACCAGGGTCTCATCCGCATGTATAAGGCCGAGTG
CCTGGAGAAGTTCCCTGTGATCCAGCACTTCAAGTTCGGGAGCCTGCTGCCCATCCATCCTGTCACGTCG
GGCTAG


Restriction Sites SgfI-MluI     
ACCN NM_178003
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_178003.2, NP_821070.1
RefSeq Size 2638 bp
RefSeq ORF 846 bp
Locus ID 5524
Cytogenetics 9q34.11
Protein Families Druggable Genome, Phosphatase
Gene Summary 'Protein phosphatase 2A is one of the four major Ser/Thr phosphatases and is implicated in the negative control of cell growth and division. Protein phosphatase 2A holoenzymes are heterotrimeric proteins composed of a structural subunit A, a catalytic subunit C, and a regulatory subunit B. The regulatory subunit is encoded by a diverse set of genes that have been grouped into the B/PR55, B'/PR61, and B''/PR72 families. These different regulatory subunits confer distinct enzymatic specificities and intracellular localizations to the holozenzyme. The product of this gene belongs to the B' family. This gene encodes a specific phosphotyrosyl phosphatase activator of the dimeric form of protein phosphatase 2A. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]'
Transcript Variant: This variant (5) lacks an in-frame segment of the coding region, compared to variant 1. It encodes a shorter protein (isoform d), also known as isoform epsilon, that is missing an internal segment compared to isoform a. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.