PPP2R4 (PTPA) (NM_178003) Human Untagged Clone
CAT#: SC307119
PPP2R4 (untagged)-Human protein phosphatase 2A activator, regulatory subunit 4 (PPP2R4), transcript variant 5
"NM_178003" in other vectors (4)
Product Images
![](https://cdn.origene.com/img/defaults-img-expression-plasmids.jpg)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | PTPA |
Synonyms | PP2A; PPP2R4; PR53 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_178003, the custom clone sequence may differ by one or more nucleotides
ATGGCTGAGGGCGAGCGGCAGCCGCCGCCAGATTCTTCAGAGGAGGCCCCTCCAGCCACTCAGAACTTCA TCATTCCAAAAAAGGAGATCCACACAGTTCCAGACATGGGCAAATGGAAGCGTTCTCAGGCATACGCTGA CTACATCGGATTCATCCTTACCCTCAACGAAGGTGTGAAGGGGAAGAAGCTGACCTTCGAGTACAGAGTC TCCGAGGAAGCAGAAAACTTGGTGGCCACAGTGGTCCCTACCCATCTGGCAGCTGCTGTGCCTGAGGTGG CTGTTTACCTAAAGGAGTCAGTGGGGAACTCCACGCGCATTGACTACGGCACAGGGCATGAGGCAGCCTT CGCTGCTTTCCTCTGCTGTCTCTGCAAGATTGGGGTGCTCCGGGTGGATGACCAAATAGCTATTGTCTTC AAGGTGTTCAATCGGTACCTTGAGGTTATGCGGAAACTCCAGAAAACATACAGGATGGAGCCAGCCGGCA GCCAGGGAGTGTGGGGTCTGGATGACTTCCAGTTTCTGCCCTTCATCTGGGGCAGTTCGCAGCTGATAGA CCACCCATACCTGGAGCCCAGACACTTTGTGGATGAGAAGGCCGTGAATGAGAACCACAAGGACTACATG TTCCTGGAGTGTATCCTGTTTATTACCGAGATGAAGACTGGCCCATTTGCAGAGCACTCCAACCAGCTGT GGAACATCAGCGCCGTCCCTTCCTGGTCCAAAGTGAACCAGGGTCTCATCCGCATGTATAAGGCCGAGTG CCTGGAGAAGTTCCCTGTGATCCAGCACTTCAAGTTCGGGAGCCTGCTGCCCATCCATCCTGTCACGTCG GGCTAG |
Restriction Sites | SgfI-MluI |
ACCN | NM_178003 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones. |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_178003.2, NP_821070.1 |
RefSeq Size | 2638 bp |
RefSeq ORF | 846 bp |
Locus ID | 5524 |
Cytogenetics | 9q34.11 |
Protein Families | Druggable Genome, Phosphatase |
Gene Summary | 'Protein phosphatase 2A is one of the four major Ser/Thr phosphatases and is implicated in the negative control of cell growth and division. Protein phosphatase 2A holoenzymes are heterotrimeric proteins composed of a structural subunit A, a catalytic subunit C, and a regulatory subunit B. The regulatory subunit is encoded by a diverse set of genes that have been grouped into the B/PR55, B'/PR61, and B''/PR72 families. These different regulatory subunits confer distinct enzymatic specificities and intracellular localizations to the holozenzyme. The product of this gene belongs to the B' family. This gene encodes a specific phosphotyrosyl phosphatase activator of the dimeric form of protein phosphatase 2A. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]' Transcript Variant: This variant (5) lacks an in-frame segment of the coding region, compared to variant 1. It encodes a shorter protein (isoform d), also known as isoform epsilon, that is missing an internal segment compared to isoform a. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC214397 | PPP2R4 (Myc-DDK-tagged)-Human protein phosphatase 2A activator, regulatory subunit 4 (PPP2R4), transcript variant 5 |
USD 420.00 |
|
RG214397 | PPP2R4 (GFP-tagged) - Human protein phosphatase 2A activator, regulatory subunit 4 (PPP2R4), transcript variant 5 |
USD 460.00 |
|
RC214397L3 | Lenti ORF clone of Human protein phosphatase 2A activator, regulatory subunit 4 (PPP2R4), transcript variant 5, Myc-DDK-tagged |
USD 620.00 |
|
RC214397L4 | Lenti ORF clone of Human protein phosphatase 2A activator, regulatory subunit 4 (PPP2R4), transcript variant 5, mGFP tagged |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review