LCE1C (NM_178351) Human Untagged Clone

CAT#: SC307165

LCE1C (untagged)-Human late cornified envelope 1C (LCE1C)

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: LCE1C
• Synonyms: LEP3
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_178351, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGTCCTGCCAGCAGAGCCAGCAGCAGTGCCAGCCCCCTCCCAAGTGCACCCCCAAGTGCCCTCCCAAGT
  GCCCCACCCCAAAGTGTCCCCCAAAGTGTCCCCCTAAGTGCCCTCCTGTCTCTTCCTGCTGCAGTGTCAG
  CTCCGGAGGCTGCTGTGGCTCCAGCTCTGGGGGCAGCTGTGGCTCCAGCTCTGGGGGATGCTGCAGTTCT
  GGGGGAGGTGGCTGCTGCCTGAGCCACCACAGGCGCCGTAGGTCCCACTGCCACAGACCCCAGAGCTCTG
  GCTGCTGCAGCCAGCCCTCGGGGGGCTCCAGCTGCTGTGGCGGGGGGAGTGGCCAGCACTCTGGAGGCTG
  CTGCTGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_178351
• ORF Size: 357 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_178351.3, NP_848128.1
• RefSeq Size: 695
• RefSeq ORF: 357
• Locus ID: 353133
• Gene Summary: Precursors of the cornified envelope of the stratum corneum. [UniProtKB/Swiss-Prot Function]
  Transcript Variant: This variant (1) represents the longer transcript and encodes the longer isoform (1). Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments.