LCE5A (NM_178438) Human Untagged Clone
CAT#: SC307179
LCE5A (untagged)-Human late cornified envelope 5A (LCE5A)
"NM_178438" in other vectors (4)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | LCE5A |
Synonyms | LEP18; SPRL5A |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_178438, the custom clone sequence may differ by one or more nucleotides
ATGTCCTGCCAGCAGAGCCAGCAGCAGTGCCAGCCTCCTCCCAAATGTACCCCTAAATGC CCTCCCAAGTGTACTCCTAAGTGTCCTCCCAAGTGTCCCCCAAAATGCCCTCCCCAGTGT TCAGCCCCATGCCCACCTCCAGTCTCTTCCTGCTGTGGTTCCAGCTCTGGGGGCTGCTGC AGCTCTGAGGGTGGTGGCTGCTGCCTGAGCCACCACAGGCCCCGCCAGTCCCTCCGACGC CGACCTCAGAGTTCCAGCTGCTGTGGCAGTGGCAGTGGCCAGCAGTCTGGGGGCTCCAGC TGCTGCCACAGCTCTGGGGGCTCTGGCTGCTGCCACAGCTCTGGAGGCTGCTGCTGA |
Restriction Sites | Please inquire |
ACCN | NM_178438 |
ORF Size | 357 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Reference Data | |
RefSeq | NM_178438.3, NP_848525.1 |
RefSeq Size | 835 |
RefSeq ORF | 357 |
Locus ID | 254910 |
Gene Summary | Precursors of the cornified envelope of the stratum corneum. [UniProtKB/Swiss-Prot Function] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC222796 | LCE5A (Myc-DDK-tagged)-Human late cornified envelope 5A (LCE5A) |
USD 420.00 |
|
RG222796 | LCE5A (GFP-tagged) - Human late cornified envelope 5A (LCE5A) |
USD 460.00 |
|
RC222796L3 | Lenti-ORF clone of LCE5A (Myc-DDK-tagged)-Human late cornified envelope 5A (LCE5A) |
USD 620.00 |
|
RC222796L4 | Lenti-ORF clone of LCE5A (mGFP-tagged)-Human late cornified envelope 5A (LCE5A) |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review