Tuberoinfundibular peptide (PTH2) (NM_178449) Human Untagged Clone

CAT#: SC307181

PTH2 (untagged)-Human parathyroid hormone 2 (PTH2)

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: PTH2
• Synonyms: TIP39
• Vector: pCMV6-XL6
• E. coli Selection: Ampicillin (100 ug/mL)
• Mammalian Cell Selection: None
• Sequence Data:
  Fully Sequenced ORF

  >OriGene sequence for NM_178449 edited
  CCGGGATGCAGCCCTACTGAGCCCCTTTCTGGTTCTCCACAGGTGATGGAGACCCGCCAG
  GTGTCCAGGAGCCCTCGGGTTCGGCTGCTGCTGCTGCTGCTGCTGCTGCTGGTGGTGCCC
  TGGGGCGTCCGCACTGCCTCGGGAGTCGCCCTGCCCCCGGTCGGGGTCCTCAGCCTCCGC
  CCCCCAGGACGGGCCTGGGCGGATCCCGCCACCCCCAGGCCGCGGAGGAGCCTGGCGCTG
  GCGGACGACGCGGCCTTCCGGGAGCGCGCGCGGTTGCTGGCCGCCCTCGAGCGCCGCCAC
  TGGCTGAACTCGTACATGCACAAGCTGCTGGTGTTGGATGCGCCCTGAGCGCGCTGCCCG
  TCCCCATCTTAATAAAGACCATGCCCTGCGCTC
  
• Restriction Sites: Please inquire
• ACCN: NM_178449
• ORF Size: 303 bp
• Insert Size: 400
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: There is 1 nucleotide difference between the OriGene clone and the NCBI reference ORF. OriGene considers this to be a polymorphism and to reflect the natural differences between individuals.

Reference Data

• RefSeq: NM_178449.2, NP_848544.1
• RefSeq Size: 459
• RefSeq ORF: 303
• Locus ID: 113091
• Protein Families: Secreted Protein, Transmembrane
• Gene Summary: This gene encodes the precursor of a peptide hormone that shares sequence similarity with the parathyroid hormone. This gene is expressed in various regions of the brain where it plays a role in the release of pituitary hormones, anxiety and nociception. The encoded precursor protein is proteolytically processed to generate the biologically active neuropeptide. [provided by RefSeq, Jul 2015]