Tuberoinfundibular peptide (PTH2) (NM_178449) Human Untagged Clone
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | PTH2 |
Synonyms | TIP39 |
Vector | pCMV6-XL6 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>OriGene sequence for NM_178449 edited
CCGGGATGCAGCCCTACTGAGCCCCTTTCTGGTTCTCCACAGGTGATGGAGACCCGCCAG GTGTCCAGGAGCCCTCGGGTTCGGCTGCTGCTGCTGCTGCTGCTGCTGCTGGTGGTGCCC TGGGGCGTCCGCACTGCCTCGGGAGTCGCCCTGCCCCCGGTCGGGGTCCTCAGCCTCCGC CCCCCAGGACGGGCCTGGGCGGATCCCGCCACCCCCAGGCCGCGGAGGAGCCTGGCGCTG GCGGACGACGCGGCCTTCCGGGAGCGCGCGCGGTTGCTGGCCGCCCTCGAGCGCCGCCAC TGGCTGAACTCGTACATGCACAAGCTGCTGGTGTTGGATGCGCCCTGAGCGCGCTGCCCG TCCCCATCTTAATAAAGACCATGCCCTGCGCTC |
Restriction Sites | Please inquire |
ACCN | NM_178449 |
ORF Size | 303 bp |
Insert Size | 400 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | There is 1 nucleotide difference between the OriGene clone and the NCBI reference ORF. OriGene considers this to be a polymorphism and to reflect the natural differences between individuals. |
Reference Data | |
RefSeq | NM_178449.2, NP_848544.1 |
RefSeq Size | 459 |
RefSeq ORF | 303 |
Locus ID | 113091 |
Protein Families | Secreted Protein, Transmembrane |
Gene Summary | This gene encodes the precursor of a peptide hormone that shares sequence similarity with the parathyroid hormone. This gene is expressed in various regions of the brain where it plays a role in the release of pituitary hormones, anxiety and nociception. The encoded precursor protein is proteolytically processed to generate the biologically active neuropeptide. [provided by RefSeq, Jul 2015] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC210906 | PTH2 (Myc-DDK-tagged)-Human parathyroid hormone 2 (PTH2) |
USD 98.00 |
|
RG210906 | PTH2 (GFP-tagged) - Human parathyroid hormone 2 (PTH2) |
USD 460.00 |
|
RC210906L1 | Lenti ORF clone of Human parathyroid hormone 2 (PTH2), Myc-DDK-tagged |
USD 620.00 |
|
RC210906L2 | Lenti ORF clone of Human parathyroid hormone 2 (PTH2), mGFP tagged |
USD 620.00 |
|
RC210906L3 | Lenti ORF clone of Human parathyroid hormone 2 (PTH2), Myc-DDK-tagged |
USD 620.00 |
|
RC210906L4 | Lenti ORF clone of Human parathyroid hormone 2 (PTH2), mGFP tagged |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review