CMTM4 (NM_178818) Human Untagged Clone
CAT#: SC307223
CMTM4 (untagged)-Human CKLF-like MARVEL transmembrane domain containing 4 (CMTM4), transcript variant 1
"NM_178818" in other vectors (4)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | CMTM4 |
Synonyms | CKLFSF4 |
Vector | pCMV6-XL5 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>OriGene ORF sequence for NM_178818 edited
ATGCGGAGCGGCGAGGAGCTGGACGGCTTCGAGGGCGAGGCCTCGAGCACCTCCATGATC TCGGGCGCCAGCAGCCCGTACCAGCCCACCACCGAGCCGGTGAGCCAGCGCCGCGGGCTG GCCGGCCTGCGCTGCGACCCCGACTACCTGCGCGGCGCGCTCGGCCGCCTCAAGGTCGCC CAAGTGATCTTGGCCCTGATTGCATTCATCTGCATAGAGACCATCATGGCATGCTCCCCG TGTGAAGGCCTCTACTTTTTTGAGTTTGTGAGCTGCAGTGCGTTTGTGGTGACTGGCGTC TTGCTGATTATGTTCAGTCTCAACCTGCACATGAGGATCCCCCAGATCAACTGGAATCTG ACAGATTTGGTCAACACTGGACTCAGCGCTTTCCTTTTCTTTATTGCTTCAATCGTACTG GCTGCTTTAAACCATAGAGCCGGAGCAGAAATTGCTGCCGTGATATTTGGCTTCTTGGAG ACTGCGGCATATGCAGTGAACACATTCCTGGCAGTGCAGAAATGGAGAGTCAGCGTCCGC CAGCAGAGCACCAATGACTACATCCGAGCCCGCACGGAGTCCAGGGATGTGGACAGTCGC CCTGAGATCCAGCGCCTGGACACTTTTTCCTACTCCACAAACGTAACAGTAAGGAAAAAA TCACCCACAAACCTGCTGAGTTTGAATCACTGGCAACTTGCCTAG |
Restriction Sites | Please inquire |
ACCN | NM_178818 |
ORF Size | 705 bp |
Insert Size | 700 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | The ORF of this clone has been fully sequenced and found to contain one SNP compared with NM_178818.2. |
Reference Data | |
RefSeq | NM_178818.2, NP_848933.1 |
RefSeq Size | 3430 |
RefSeq ORF | 705 |
Locus ID | 146223 |
Protein Families | Transmembrane |
Gene Summary | This gene belongs to the chemokine-like factor gene superfamily, a novel family that is similar to the chemokine and the transmembrane 4 superfamilies of signaling molecules. This gene is one of several chemokine-like factor genes located in a cluster on chromosome 16. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (1) represents the longer transcript and encodes the longer isoform (1). |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC217697 | CMTM4 (Myc-DDK-tagged)-Human CKLF-like MARVEL transmembrane domain containing 4 (CMTM4), transcript variant 1 |
USD 420.00 |
|
RG217697 | CMTM4 (GFP-tagged) - Human CKLF-like MARVEL transmembrane domain containing 4 (CMTM4), transcript variant 1 |
USD 460.00 |
|
RC217697L3 | Lenti ORF clone of Human CKLF-like MARVEL transmembrane domain containing 4 (CMTM4), transcript variant 1, Myc-DDK-tagged |
USD 620.00 |
|
RC217697L4 | Lenti ORF clone of Human CKLF-like MARVEL transmembrane domain containing 4 (CMTM4), transcript variant 1, mGFP tagged |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review