CMTM4 (NM_178818) Human Untagged Clone

CAT#: SC307223

CMTM4 (untagged)-Human CKLF-like MARVEL transmembrane domain containing 4 (CMTM4), transcript variant 1


  "NM_178818" in other vectors (4)

Reconstitution Protocol

USD 420.00

In Stock*

Size
    • 10 ug

Product Images

Other products for "CMTM4"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol CMTM4
Synonyms CKLFSF4
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>OriGene ORF sequence for NM_178818 edited
ATGCGGAGCGGCGAGGAGCTGGACGGCTTCGAGGGCGAGGCCTCGAGCACCTCCATGATC
TCGGGCGCCAGCAGCCCGTACCAGCCCACCACCGAGCCGGTGAGCCAGCGCCGCGGGCTG
GCCGGCCTGCGCTGCGACCCCGACTACCTGCGCGGCGCGCTCGGCCGCCTCAAGGTCGCC
CAAGTGATCTTGGCCCTGATTGCATTCATCTGCATAGAGACCATCATGGCATGCTCCCCG
TGTGAAGGCCTCTACTTTTTTGAGTTTGTGAGCTGCAGTGCGTTTGTGGTGACTGGCGTC
TTGCTGATTATGTTCAGTCTCAACCTGCACATGAGGATCCCCCAGATCAACTGGAATCTG
ACAGATTTGGTCAACACTGGACTCAGCGCTTTCCTTTTCTTTATTGCTTCAATCGTACTG
GCTGCTTTAAACCATAGAGCCGGAGCAGAAATTGCTGCCGTGATATTTGGCTTCTTGGAG
ACTGCGGCATATGCAGTGAACACATTCCTGGCAGTGCAGAAATGGAGAGTCAGCGTCCGC
CAGCAGAGCACCAATGACTACATCCGAGCCCGCACGGAGTCCAGGGATGTGGACAGTCGC
CCTGAGATCCAGCGCCTGGACACTTTTTCCTACTCCACAAACGTAACAGTAAGGAAAAAA
TCACCCACAAACCTGCTGAGTTTGAATCACTGGCAACTTGCCTAG
Restriction Sites Please inquire     
ACCN NM_178818
ORF Size 705 bp
Insert Size 700
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation The ORF of this clone has been fully sequenced and found to contain one SNP compared with NM_178818.2.
Reference Data
RefSeq NM_178818.2, NP_848933.1
RefSeq Size 3430
RefSeq ORF 705
Locus ID 146223
Protein Families Transmembrane
Gene Summary This gene belongs to the chemokine-like factor gene superfamily, a novel family that is similar to the chemokine and the transmembrane 4 superfamilies of signaling molecules. This gene is one of several chemokine-like factor genes located in a cluster on chromosome 16. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (1) represents the longer transcript and encodes the longer isoform (1).

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.