N acetyl transferase 5 (NAA20) (NM_181528) Human Untagged Clone

CAT#: SC307298

NAA20 (untagged)-Human N(alpha)-acetyltransferase 20, NatB catalytic subunit (NAA20), transcript variant 3

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: NAA20
• Synonyms: dJ1002M8.1; NAT3; NAT3P; NAT5; NAT5P
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_181528, the custom clone sequence may differ by one or more nucleotides
  ATGACCACGCTACGGGCCTTTACCTGCGACGACCTGTTCCGCTTCAACAACATTAACTTG
  GATCCACTTACAGAAACTTATGGGATTCCTTTCTACCTACAATACCTCGCCCACTGGCCA
  GAGTATTTCATTGTTGCAGAGGCACCTGGTGGAGAATTAATGGGTTATATTATGGGTAAA
  GCAGAAGGCTCAGTAGCTAGGGAAGAATGGCACGGGCACGTCACAGCTCTGTCTGTTGCC
  CCAGAATTTCGACGCCTTGGTTTGGCTGCTAAACTTATGGAGTTACTAGAGGAGATTTCA
  GAAAGATATGAGGAAAGCACTTTCCAGGGATACTGA
  
• Restriction Sites: Please inquire
• ACCN: NM_181528
• ORF Size: 336 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_181528.1, NP_852669.1
• RefSeq Size: 1214
• RefSeq ORF: 336
• Locus ID: 51126
• Protein Pathways: Glycerophospholipid metabolism, Limonene and pinene degradation, Phenylalanine metabolism, Tyrosine metabolism
• Gene Summary: NAT5 is a component of N-acetyltransferase complex B (NatB). Human NatB performs cotranslational N(alpha)-terminal acetylation of methionine residues when they are followed by asparagine (Starheim et al., 2008 [PubMed 18570629]). [supplied by OMIM, Apr 2009]
  Transcript Variant: This variant (3) lacks an alternate exon compared to variant 1, which causes a frameshift. The exon combination for the transcript is supported by full-length ESTs (BG548527.1 and CD641402.1). The resulting isoform (c) is shorter and has a distinct C-terminus compared to isoform a.