CKLF (NM_181641) Human Untagged Clone

CAT#: SC307335

CKLF (untagged)-Human chemokine-like factor (CKLF), transcript variant 4

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: CKLF
• Synonyms: C32; CKLF1; CKLF2; CKLF3; CKLF4; HSPC224; UCK-1
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_181641, the custom clone sequence may differ by one or more nucleotides
  ATGGATAACGTGCAGCCGAAAATAAAACATCGCCCCTTCTGCTTCAGTGTGAAAGGCCAC
  GTGAAGATGCTGCGGCTGGCACTAACTGTGACATCTATGACCTTTTTTATCATCGCACAA
  GCCCCTGAACCATATATTGTTATCACTGGATTTGAAGTCACCGTTATCTTATTTTTCATA
  CTTTTATATGTACTCAGACTTGATCGATTAATGAAGTGGTTATTTTGGCCTTTGCTTGTG
  TTTGCACTTGTGACAGCAGTATGCTGTCTTGCCGACGGGGCCCTTATTTACCGGAAGCTT
  CTGTTCAATCCCAGCGGTCCTTACCAGAAAAAGCCTGTGCATGAAAAAAAAGAAGTTTTG
  TAA
  
• Restriction Sites: Please inquire
• ACCN: NM_181641
• ORF Size: 363 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_181641.1, NP_857592.1
• RefSeq Size: 593
• RefSeq ORF: 363
• Locus ID: 51192
• Protein Families: Druggable Genome, Secreted Protein, Transmembrane
• Gene Summary: The product of this gene is a cytokine. Cytokines are small proteins that have an essential role in the immune and inflammatory responses. This gene is one of several chemokine-like factor genes located in a cluster on chromosome 16. The protein encoded by this gene is a potent chemoattractant for neutrophils, monocytes and lymphocytes. It also can stimulate the proliferation of skeletal muscle cells. This protein may play important roles in inflammation and in the regeneration of skeletal muscle. Alternatively spliced transcript variants encoding different isoforms have been identified. Naturally occurring read-through transcription occurs between this locus and the neighboring locus CMTM1 (CKLF-like MARVEL transmembrane domain containing 1). [provided by RefSeq, Feb 2011]
  Transcript Variant: This variant (4) lacks an in-frame segment of the coding region, compared to variant 1. It encodes a shorter isoform (d), also known as an isoform CKLF4.