CKLF (NM_181641) Human Untagged Clone

CAT#: SC307335

CKLF (untagged)-Human chemokine-like factor (CKLF), transcript variant 4


  "NM_181641" in other vectors (4)

Reconstitution Protocol

USD 420.00

2 Weeks*

Size
    • 10 ug

Product Images

Other products for "CKLF"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol CKLF
Synonyms C32; CKLF1; CKLF2; CKLF3; CKLF4; HSPC224; UCK-1
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_181641, the custom clone sequence may differ by one or more nucleotides
ATGGATAACGTGCAGCCGAAAATAAAACATCGCCCCTTCTGCTTCAGTGTGAAAGGCCAC
GTGAAGATGCTGCGGCTGGCACTAACTGTGACATCTATGACCTTTTTTATCATCGCACAA
GCCCCTGAACCATATATTGTTATCACTGGATTTGAAGTCACCGTTATCTTATTTTTCATA
CTTTTATATGTACTCAGACTTGATCGATTAATGAAGTGGTTATTTTGGCCTTTGCTTGTG
TTTGCACTTGTGACAGCAGTATGCTGTCTTGCCGACGGGGCCCTTATTTACCGGAAGCTT
CTGTTCAATCCCAGCGGTCCTTACCAGAAAAAGCCTGTGCATGAAAAAAAAGAAGTTTTG
TAA
Restriction Sites Please inquire     
ACCN NM_181641
ORF Size 363 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Reference Data
RefSeq NM_181641.1, NP_857592.1
RefSeq Size 593
RefSeq ORF 363
Locus ID 51192
Protein Families Druggable Genome, Secreted Protein, Transmembrane
Gene Summary The product of this gene is a cytokine. Cytokines are small proteins that have an essential role in the immune and inflammatory responses. This gene is one of several chemokine-like factor genes located in a cluster on chromosome 16. The protein encoded by this gene is a potent chemoattractant for neutrophils, monocytes and lymphocytes. It also can stimulate the proliferation of skeletal muscle cells. This protein may play important roles in inflammation and in the regeneration of skeletal muscle. Alternatively spliced transcript variants encoding different isoforms have been identified. Naturally occurring read-through transcription occurs between this locus and the neighboring locus CMTM1 (CKLF-like MARVEL transmembrane domain containing 1). [provided by RefSeq, Feb 2011]
Transcript Variant: This variant (4) lacks an in-frame segment of the coding region, compared to variant 1. It encodes a shorter isoform (d), also known as an isoform CKLF4.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.