CKLF (NM_181641) Human Untagged Clone
CAT#: SC307335
CKLF (untagged)-Human chemokine-like factor (CKLF), transcript variant 4
"NM_181641" in other vectors (4)
Product Images
![](https://cdn.origene.com/img/defaults-img-expression-plasmids.jpg)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | CKLF |
Synonyms | C32; CKLF1; CKLF2; CKLF3; CKLF4; HSPC224; UCK-1 |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_181641, the custom clone sequence may differ by one or more nucleotides
ATGGATAACGTGCAGCCGAAAATAAAACATCGCCCCTTCTGCTTCAGTGTGAAAGGCCAC GTGAAGATGCTGCGGCTGGCACTAACTGTGACATCTATGACCTTTTTTATCATCGCACAA GCCCCTGAACCATATATTGTTATCACTGGATTTGAAGTCACCGTTATCTTATTTTTCATA CTTTTATATGTACTCAGACTTGATCGATTAATGAAGTGGTTATTTTGGCCTTTGCTTGTG TTTGCACTTGTGACAGCAGTATGCTGTCTTGCCGACGGGGCCCTTATTTACCGGAAGCTT CTGTTCAATCCCAGCGGTCCTTACCAGAAAAAGCCTGTGCATGAAAAAAAAGAAGTTTTG TAA |
Restriction Sites | Please inquire |
ACCN | NM_181641 |
ORF Size | 363 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Reference Data | |
RefSeq | NM_181641.1, NP_857592.1 |
RefSeq Size | 593 |
RefSeq ORF | 363 |
Locus ID | 51192 |
Protein Families | Druggable Genome, Secreted Protein, Transmembrane |
Gene Summary | The product of this gene is a cytokine. Cytokines are small proteins that have an essential role in the immune and inflammatory responses. This gene is one of several chemokine-like factor genes located in a cluster on chromosome 16. The protein encoded by this gene is a potent chemoattractant for neutrophils, monocytes and lymphocytes. It also can stimulate the proliferation of skeletal muscle cells. This protein may play important roles in inflammation and in the regeneration of skeletal muscle. Alternatively spliced transcript variants encoding different isoforms have been identified. Naturally occurring read-through transcription occurs between this locus and the neighboring locus CMTM1 (CKLF-like MARVEL transmembrane domain containing 1). [provided by RefSeq, Feb 2011] Transcript Variant: This variant (4) lacks an in-frame segment of the coding region, compared to variant 1. It encodes a shorter isoform (d), also known as an isoform CKLF4. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC217193 | CKLF (Myc-DDK-tagged)-Human chemokine-like factor (CKLF), transcript variant 4 |
USD 420.00 |
|
RG217193 | CKLF (GFP-tagged) - Human chemokine-like factor (CKLF), transcript variant 4 |
USD 460.00 |
|
RC217193L3 | Lenti-ORF clone of CKLF (Myc-DDK-tagged)-Human chemokine-like factor (CKLF), transcript variant 4 |
USD 620.00 |
|
RC217193L4 | Lenti-ORF clone of CKLF (mGFP-tagged)-Human chemokine-like factor (CKLF), transcript variant 4 |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review