Rad6 (UBE2A) (NM_181762) Human Untagged Clone

CAT#: SC307361

UBE2A (untagged)-Human ubiquitin-conjugating enzyme E2A (UBE2A), transcript variant 2


  "NM_181762" in other vectors (4)

Reconstitution Protocol

USD 420.00

2 Weeks*

Size
    • 10 ug

Product Images

Other products for "UBE2A"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol UBE2A
Synonyms HHR6A; MRXS30; MRXSN; RAD6A; UBC2
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_181762, the custom clone sequence may differ by one or more nucleotides
ATGTCCACCCCGGCTCGGCGGCGCCTCATGCGGGACTTCAAGAGGTTGCAGGAGGATCCT
CCAGCCGGAGTCAGCGGGGCTCCGTCCGAGAACAACATAATGGTGTGGAACGCGGTCATT
TTCGGGCCTGAAGGGACCCCGTTTGAGGATGTCTATGCAGATGGTAGTATATGTCTGGAC
ATACTTCAGAACCGTTGGAGTCCAACCTATGATGTGTCTTCCATTCTAACATCCATACAG
TCTCTGTTGGATGAACCCAATCCCAATAGTCCAGCAAACAGCCAGGCTGCTCAGCTGTAC
CAGGAGAACAAACGGGAATATGAAAAGCGTGTTTCTGCAATAGTAGAACAAAGCTGGCGT
GATTGTTGA
Restriction Sites Please inquire     
ACCN NM_181762
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_181762.1, NP_861427.1
RefSeq Size 1709 bp
RefSeq ORF 369 bp
Locus ID 7319
Cytogenetics Xq24
Protein Families Druggable Genome
Protein Pathways Ubiquitin mediated proteolysis
Gene Summary 'The modification of proteins with ubiquitin is an important cellular mechanism for targeting abnormal or short-lived proteins for degradation. Ubiquitination involves at least three classes of enzymes: ubiquitin-activating enzymes, ubiquitin-conjugating enzymes, and ubiquitin-protein ligases. This gene encodes a member of the E2 ubiquitin-conjugating enzyme family. This enzyme is required for post-replicative DNA damage repair, and may play a role in transcriptional regulation. Mutations in this gene are associated with cognitive disability. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2013]'
Transcript Variant: This variant (2) lacks an in-frame exon in the central coding region, compared to variant 1. The encoded isoform (2) is shorter, compared to isoform 1.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.