KCNQ1 (NM_181798) Human Untagged Clone
CAT#: SC307372
KCNQ1 (untagged)-Human potassium voltage-gated channel, KQT-like subfamily, member 1 (KCNQ1), transcript variant 2
"NM_181798" in other vectors (6)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | KCNQ1 |
Synonyms | ATFB1; ATFB3; JLNS1; KCNA8; KCNA9; Kv1.9; Kv7.1; KVLQT1; LQT; LQT1; RWS; SQT2; WRS |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_181798, the custom clone sequence may differ by one or more nucleotides
ATGGACTTCCTCATCGTCCTGGTCTGCCTCATCTTCAGCGTGCTGTCCACCATCGAGCAGTATGCCGCCC TGGCCACGGGGACTCTCTTCTGGATGGAGATCGTGCTGGTGGTGTTCTTCGGGACGGAGTACGTGGTCCG CCTCTGGTCCGCCGGCTGCCGCAGCAAGTACGTGGGCCTCTGGGGGCGGCTGCGCTTTGCCCGGAAGCCC ATTTCCATCATCGACCTCATCGTGGTCGTGGCCTCCATGGTGGTCCTCTGCGTGGGCTCCAAGGGGCAGG TGTTTGCCACGTCGGCCATCAGGGGCATCCGCTTCCTGCAGATCCTGAGGATGCTACACGTCGACCGCCA GGGAGGCACCTGGAGGCTCCTGGGCTCCGTGGTCTTCATCCACCGCCAGGAGCTGATAACCACCCTGTAC ATCGGCTTCCTGGGCCTCATCTTCTCCTCGTACTTTGTGTACCTGGCTGAGAAGGACGCGGTGAACGAGT CAGGCCGCGTGGAGTTCGGCAGCTACGCAGATGCGCTGTGGTGGGGGGTGGTCACAGTCACCACCATCGG CTATGGGGACAAGGTGCCCCAGACGTGGGTCGGGAAGACCATCGCCTCCTGCTTCTCTGTCTTTGCCATC TCCTTCTTTGCGCTCCCAGCGGGGATTCTTGGCTCGGGGTTTGCCCTGAAGGTGCAGCAGAAGCAGAGGC AGAAGCACTTCAACCGGCAGATCCCGGCGGCAGCCTCACTCATTCAGACCGCATGGAGGTGCTATGCTGC CGAGAACCCCGACTCCTCCACCTGGAAGATCTACATCCGGAAGGCCCCCCGGAGCCACACTCTGCTGTCA CCCAGCCCCAAACCCAAGAAGTCTGTGGTGGTAAAGAAAAAAAAGTTCAAGCTGGACAAAGACAATGGGG TGACTCCTGGAGAGAAGATGCTCACAGTCCCCCATATCACGTGCGACCCCCCAGAAGAGCGGCGGCTGGA CCACTTCTCTGTCGACGGCTATGACAGTTCTGTAAGGAAGAGCCCAACACTGCTGGAAGTGAGCATGCCC CATTTCATGAGAACCAACAGCTTCGCCGAGGACCTGGACCTGGAAGGGGAGACTCTGCTGACACCCATCA CCCACATCTCACAGCTGCGGGAACACCATCGGGCCACCATTAAGGTCATTCGACGCATGCAGTACTTTGT GGCCAAGAAGAAATTCCAGCAAGCGCGGAAGCCTTACGATGTGCGGGACGTCATTGAGCAGTACTCGCAG GGCCACCTCAACCTCATGGTGCGCATCAAGGAGCTGCAGAGGAGGCTGGACCAGTCCATTGGGAAGCCCT CACTGTTCATCTCCGTCTCAGAAAAGAGCAAGGATCGCGGCAGCAACACGATCGGCGCCCGCCTGAACCG AGTAGAAGACAAGGTGACGCAGCTGGACCAGAGGCTGGCACTCATCACCGACATGCTTCACCAGCTGCTC TCCTTGCACGGTGGCAGCACCCCCGGCAGCGGCGGCCCCCCCAGAGAGGGCGGGGCCCACATCACCCAGC CCTGCGGCAGTGGCGGCTCCGTCGACCCTGAGCTCTTCCTGCCCAGCAACACCCTGCCCACCTACGAGCA GCTGACCGTGCCCAGGAGGGGCCCCGATGAGGGGTCCTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_181798 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones. |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_181798.1, NP_861463.1 |
RefSeq Size | 3029 bp |
RefSeq ORF | 1650 bp |
Locus ID | 3784 |
Cytogenetics | 11p15.5-p15.4 |
Protein Families | Druggable Genome, Ion Channels: Potassium, Transmembrane |
Protein Pathways | Vibrio cholerae infection |
Gene Summary | 'This gene encodes a voltage-gated potassium channel required for repolarization phase of the cardiac action potential. This protein can form heteromultimers with two other potassium channel proteins, KCNE1 and KCNE3. Mutations in this gene are associated with hereditary long QT syndrome 1 (also known as Romano-Ward syndrome), Jervell and Lange-Nielsen syndrome, and familial atrial fibrillation. This gene exhibits tissue-specific imprinting, with preferential expression from the maternal allele in some tissues, and biallelic expression in others. This gene is located in a region of chromosome 11 amongst other imprinted genes that are associated with Beckwith-Wiedemann syndrome (BWS), and itself has been shown to be disrupted by chromosomal rearrangements in patients with BWS. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Aug 2011]' Transcript Variant: This variant (2) contains an alternate 5' terminal exon and initiates translation from an alternate start site compared to variant 1. The resulting shorter isoform (2) has a distinct N-terminus compared to isoform 1. |
Documents
Product Manuals |
FAQs |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC212479 | KCNQ1 (Myc-DDK-tagged)-Human potassium voltage-gated channel, KQT-like subfamily, member 1 (KCNQ1), transcript variant 2 |
USD 420.00 |
|
RG212479 | KCNQ1 (GFP-tagged) - Human potassium voltage-gated channel, KQT-like subfamily, member 1 (KCNQ1), transcript variant 2 |
USD 460.00 |
|
RC212479L1 | Lenti ORF clone of Human potassium voltage-gated channel, KQT-like subfamily, member 1 (KCNQ1), transcript variant 2, Myc-DDK-tagged |
USD 768.00 |
|
RC212479L2 | Lenti ORF clone of Human potassium voltage-gated channel, KQT-like subfamily, member 1 (KCNQ1), transcript variant 2, mGFP tagged |
USD 620.00 |
|
RC212479L3 | Lenti ORF clone of Human potassium voltage-gated channel, KQT-like subfamily, member 1 (KCNQ1), transcript variant 2, Myc-DDK-tagged |
USD 620.00 |
|
RC212479L4 | Lenti ORF clone of Human potassium voltage-gated channel, KQT-like subfamily, member 1 (KCNQ1), transcript variant 2, mGFP tagged |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review