NF2 (NM_181831) Human Untagged Clone

CAT#: SC307382

NF2 (untagged)-Human neurofibromin 2 (merlin) (NF2), transcript variant 13


  "NM_181831" in other vectors (4)

Reconstitution Protocol

USD 760.00

3 Weeks*

Size
    • 10 ug

Product Images

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol NF2
Synonyms ACN; BANF; SCH
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_181831, the custom clone sequence may differ by one or more nucleotides


ATGGCCGGGGCCATCGCTTCCCGCATGAGCTTCAGCTCTCTCAAGAGGAAGCAACCCAAGACGTTCACCG
TGAGGATCGTCACCATGGACGCCGAGATGGAGTTCAATTGCGAGGTAAAGAAGCAGATTTTAGATGAAAA
GATCTACTGCCCTCCTGAGGCTTCTGTGCTCCTGGCTTCTTACGCCGTCCAGGCCAAGTATGGTGACTAC
GACCCCAGTGTTCACAAGCGGGGATTTTTGGCCCAAGAGGAATTGCTTCCAAAAAGGGTAATAAATCTGT
ATCAGATGACTCCGGAAATGTGGGAGGAGAGAATTACTGCTTGGTACGCAGAGCACCGAGGCCGAGCCAG
GGATGAAGCTGAAATGGAATATCTGAAGATAGCTCAGGACCTGGAGATGTACGGTGTGAACTACTTTGCA
ATCCGGAATAAAAAGGGCACAGAGCTGCTGCTTGGAGTGGATGCCCTGGGGCTTCACATTTATGACCCTG
AGAACAGACTGACCCCCAAGATCTCCTTCCCGTGGAATGAAATCCGAAACATCTCGTACAGTGACAAGGA
GTTTACTATTAAACCACTGGATAAGAAAATTGATGTCTTCAAGTTTAACTCCTCAAAGCTTCGTGTTAAT
AAGCTGATTCTCCAGCTATGTATCGGGAACCATGATCTATTTATGAGGAGAAGGAAAGCCGATTCTTTGG
AAGTTCAGCAGATGAAAGCCCAGGCCAGGGAGGAGAAGGCTAGAAAGCAGATGGAGCGGCAGCGCCTCGC
TCGAGAGAAGCAGATGAGGGAGGAGGCTGAACGCACGAGGGATGAGTTGGAGAGGAGGCTGCTGCAGATG
AAAGAAGAAGCAACAATGGCCAACGAAGCACTGATGCGGTCTGAGGAGACAGCTGACCTGTTGGCTGAAA
AGGCCCAGATCACCGAGGAGGAGGCAAAACTTCTGGCCCAGAAGGCCGCAGAGGCTGAGCAGGAAATGCA
GCGCATCAAGGCCACAGCGATTCGCACGGAGGAGGAGAAGCGCCTGATGGAGCAGAAGGTGCTGGAAGCC
GAGGTGCTGGCACTGAAGATGGCTGAGGAGTCAGAGAGGAGGGCCAAAGAGGCAGATCAGCTGAAGCAGG
ACCTGCAGGAAGCACGCGAGGCGGAGCGAAGAGCCAAGCAGAAGCTCCTGGAGATTGCCACCAAGCCCAC
GTACCCGCCCATGAACCCAATTCCAGCACCGTTGCCTCCTGACATACCAAGCTTCAACCTCATTGGTGAC
AGCCTGTCTTTCGACTTCAAAGATACTGACATGAAGCGGCTTTCCATGGAGATAGAGAAAGAAAAAGTGG
AATACATGGAAAAGAGCAAGCATCTGCAGGAGCAGCTCAATGAACTCAAGACAGAAATCGAGGCCTTGAA
ACTGAAAGAGAGGGAGACAGCTCTGGATATTCTGCACAATGAGAACTCCGACAGGGGTGGCAGCAGCAAG
CACAATACCATTAAAAAGCCTCAAGCCCAAGGCAGAAGACCTATCTGCATTTGA


Restriction Sites SgfI-MluI     
ACCN NM_181831
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_181831.2, NP_861969.1
RefSeq Size 2217 bp
RefSeq ORF 1524 bp
Locus ID 4771
Cytogenetics 22q12.2
Protein Families Druggable Genome
Gene Summary 'This gene encodes a protein that is similar to some members of the ERM (ezrin, radixin, moesin) family of proteins that are thought to link cytoskeletal components with proteins in the cell membrane. This gene product has been shown to interact with cell-surface proteins, proteins involved in cytoskeletal dynamics and proteins involved in regulating ion transport. This gene is expressed at high levels during embryonic development; in adults, significant expression is found in Schwann cells, meningeal cells, lens and nerve. Mutations in this gene are associated with neurofibromatosis type II which is characterized by nervous system and skin tumors and ocular abnormalities. Two predominant isoforms and a number of minor isoforms are produced by alternatively spliced transcripts. [provided by RefSeq, Jul 2008]'
Transcript Variant: This variant (13) lacks two alternate in-frame exons in the 5' coding region and differs in the 3' coding region and UTR, compared to variant 1. The resulting protein (isoform 7, also referred to as isoform delE2/3) is shorter and has a distinct C-terminus, compared to isoform 1.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.