NORE1 (RASSF5) (NM_182664) Human Untagged Clone

CAT#: SC307477

RASSF5 (untagged)-Human Ras association (RalGDS/AF-6) domain family member 5 (RASSF5), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: RASSF5
• Synonyms: Maxp1; NORE1; NORE1A; NORE1B; RAPL; RASSF3
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_182664, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGCCATGGCGTCCCCGGCCATCGGGCAGCGCCCGTACCCGCTACTATTGGACCCCGAGCCGCCGCGCT
  ATCTACAGAGCCTGAGCGGCCCCGAGCTACCGCCGCCGCCCCCCGACCGGTCCTCGCGCCTCTGTGTCCC
  GGCGCCCCTCTCCACTGCGCCCGGGGCGCGCGAGGGGCGCAGCGCCCGGAGGGCTGCCCGGGGGAACCTG
  GAGCCCCCGCCCCGGGCCTCCCGACCCGCTCGCCCGCTCCGGCCTGGTCTGCAGCAGAGACTGCGGCGGC
  GGCCTGGAGCGCCCCGACCCCGCGACGTGCGGAGCATCTTCGAGCAGCCGCAGGATCCCAGAGTCCCGGC
  GGAGCGAGGCGAGGGGCACTGCTTCGCCGAGTTGGTGCTGCCGGGCGGCCCCGGCTGGTGTGACCTGTGC
  GGACGAGAGGTGCTGCGGCAGGCGCTGCGCTGCACTAACTGTAAATTCACCTGTCACCCAGAATGCCGCA
  GCCTGATCCAGTTGGACTGCAGTCAGCAGGAGGGTTTATCCCGGGACAGACCCTCTCCAGAAAGCACCCT
  CACCGTGACCTTCAGCCAGAATGTCTGTAAACCTGTGGAGGAGACACAGCGCCCGCCCACACTGCAGGAG
  ATCAAGCAGAAGATCGACAGCTACAACACGCGAGAGAAGAACTGCCTGGGCATGAAACTGAGTGAAGACG
  GCACCTACACGGGTTTCATCAAAGTGCATCTGAAACTCCGGCGGCCTGTGACGGTGCCTGCTGGGATCCG
  GCCCCAGTCCATCTATGATGCCATCAAGGAGGTGAACCTGGCGGCTACCACGGACAAGCGGACATCCTTC
  TACCTGCCCCTAGATGCCATCAAGCAGCTGCACATCAGCAGCACCACCACCGTCAGTGAGGTCATCCAGG
  GGCTGCTCAAGAAGTTCATGGTTGTGGACAATCCCCAGAAGTTTGCACTTTTTAAGCGGATACACAAGGA
  CGGACAAGTGGGATGCCTTCTCCATCCCTGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_182664
• ORF Size: 1011 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_182664.3, NP_872605.1
• RefSeq Size: 3537
• RefSeq ORF: 1011
• Locus ID: 83593
• Protein Families: Druggable Genome
• Protein Pathways: Leukocyte transendothelial migration, Non-small cell lung cancer, Pathways in cancer
• Gene Summary: This gene is a member of the Ras association domain family. It functions as a tumor suppressor, and is inactivated in a variety of cancers. The encoded protein localizes to centrosomes and microtubules, and associates with the GTP-activated forms of Ras, Rap1, and several other Ras-like small GTPases. The protein regulates lymphocyte adhesion and suppresses cell growth in response to activated Rap1 or Ras. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
  Transcript Variant: This variant (2) lacks an alternate exon in the 3' coding region, compared to variant 1, that causes a frameshift. The resulting protein (isoform B) is shorter and has a distinct C-terminus, compared to isoform A.